Thioredoxin regulates the redox state and the activity of the human tRNA ligase complex

Cell culture

HeLa Kyoto, HeLa RIEP (Jurkin et al. 2014) and HEK293 Flip-In T-REx (FITR, Invitrogen) cells were cultured in Dulbecco's modified Eagle's medium (DMEM high glucose, Gibco, #41966-052) supplemented with 10% fetal bovine serum (FBS, Gibco, #A5256701), 100 µg/mL penicillin/100 µg/mL streptomycin (Sigma Aldrich, #P0781-100ml), and 20 mM HEPES pH 7.0 (Gibco, #15630-122), at 37°C, 5% CO₂. Cells were regularly tested for mycoplasma contamination.

Generation of Dox-inducible shRNA cells lines and induction of shRNA expression

For generation of Doxycycline-inducible shRNA cell lines, HeLa RIEP cells were transduced with ecotropically packaged shRNA expression vectors (pSIN-TRE3G-GFP-miRE-PGK-Neo, see “Cloning of shRNAs”) or rescue vectors (pBMN-FLAG-IRES-GFP, see “Cloning of shRNA-resistant TRX-rescue constructs”), as described before (Fellmann et al. 2013). For retroviral packaging, Platinum E cells (PlatE, Cell Biolabs), were seeded into 10 cm² plates and transfected at 90% confluency with 20 µg plasmid DNA and 10 µg helper plasmid (pCMV-Gag-Pol, Cell Biolabs), using CalPhos Mammalian Transfection Kit (Clontech/Takara, #631312), according to the manufacturer's instructions. The transfection medium was replaced to complete DMEM after 16 h. Virus-containing supernatants were harvested at 36, 48, and 60 h post-transfection and added dropwise onto HeLa RIEP cells for transduction. Cells expressing the shRNA constructs were selected using 1 mg/mL Neomycin (Calbiochem, #480100). To induce expression of shRNAs, cells were treated for 3 d with 2 µg/mL Dox.

XBP1 splicing reporter

The XBP1 splicing reporter was designed similar to previously described studies (Lu et al. 2014). A 120-mer oligonucleotide containing the XBP1 intron was synthesized (Sigma Aldrich, sequence, intron in bold: 5′-AGCCAAGGGGAATGAAGTGAGGCCAGTGGCCGGGTCTGCTGAGTCCGCAGCACTCAGACTACGTGCACCTCTGCAGCAGGTGCAGGCCCAGTTGTCACCCCTCCAGAACATCTCCCCATG-3′), flanked by restriction sites and cloned into a pcDNA5-FRT vector containing EGFP and mCherry sequences. For generation of stable HEK293 FITR cells expressing the GFP-XBP1^intron-mCherry reporter, cells were seeded into a six-well plate and transfected at 50% confluency. An amount of 1.5 µg of plasmid DNA and 1.5 µg pOG44 (encoding the Flp recombinase) were mixed and transfected using CalPhos Mammalian Transfection Kit (Clontech/Takara, #631312). The transfection medium was replaced by complete DMEM after 24 h, and after a further 24 h, the selection of positive clones was started using 0.5 mg/mL Hygromycin B. Colonies appeared after 14 d of selection. For UPR-related experiments, silencing of TRX or RTCB and Archease was done as described below. Expression of the GFP-XBP1^intron-mCherry was induced for 5 h; 1 h later, menadione and Tm were added to the cells. Cells were harvested by trypsinization, pellets were resuspended in FACS buffer (PBS + 2% FCS) and analyzed by flow cytometry (BD LSRFortessa) and FlowJo software.

Silencing of TRX using siRNA

For depletion of proteins using RNAi, cells were seeded 1 d before transfection. Small interfering RNAs (siRNA) targeting human TXN (siTRX) or scrambled control (siCtrl) consisted of siRNA pools of 30 siRNAs and were purchased from siTOOLs Biotech. HeLa cells were transfected at 30%–40% confluency using Lipofectamine RNAiMax (Invitrogen, #13778-150), according to the manufacturer's instructions. Subsequent experiments were performed after 3 d of silencing.

Treatment with inhibitors and UPR induction

For treatment with inhibitors or oxidants, HeLa Kyoto cells were seeded into six-well plates and treated at 90% confluency. A list of compounds and inhibitors used in this work can be found in Table 1. For induction of the UPR in HeLa RIEP shRNA cells, knockdown of TRX was induced using 2 µg/mL Dox for 3 d. Cells were treated at 80% confluency with 300 nM Thapsigargin (Sigma Aldrich) or 1.5 µg/mL Tunicamycin (Sigma Aldrich).

Cloning of shRNAs

For RNAi-mediated depletion of TRX, shRNAs targeting TXN mRNA were designed using the online siRNA prediction tool “SplashRNA” (http://splashrna.mskcc.org) (Fellmann et al. 2013; Pelossof et al. 2017). The sequence of shCtrl and shTRX shRNA guides can be found in Table 2. The respective 97-mer oligonucleotides (Sigma Aldrich; for guide sequences, see Table 2) were amplified by PCR using the following conditions: 0.5 ng of template DNA, 0.5 µL of Phusion polymerase (NEB, #M0530S), 1× buffer GC, 3% DMSO, 0.3 mM dNTP (Thermo Fisher, #R0193), 0.3 µM of each primer (miR30_fwd: 5′-CAG AAG GCT CGA GAA GGT ATA TTG CTG TTG ACA GTG AGC G-3′ and miR30_rev: 5′-CTA AAG TAG CCC CTT GAA TTC CGA GGC AGT AGG CA-3′). The PCR was performed using the following protocol: 95°C for 2 min; 33 cycles of 95°C for 15 sec, 58°C for 30 sec, and 72°C for 25 sec; 72°C for 5 min. PCR products were purified using the QIAquick PCR Purification Kit (Qiagen, #28104), according to the manufacturer's instructions. Purified PCR products and the destination vector pSIN-TRE3G-GFP-miRE-PGK-Neo were digested with XhoI/EcoRI 37°C for 1 h, and the PCR product was ligated into the destination vector using T4 DNA ligase (NEB, #M0202L) overnight at 16°C.

Cloning of shRNA-resistant TRX-rescue constructs

The sequence of human TRX cDNA was adapted to be nontargetable by shTRX #6. The cDNA of WT (CxxC), C35S (CxxS), and the double mutant C32S/C35S (SxxS) was cloned into pDONR221 (Invitrogen) by Gateway recombination. Sequences were subsequently shuttled from the pDONR221 construct into pBMN-FLAG-IRES-GFP (introducing an amino-terminal FLAG epitope tag) that was used to generate stable cell lines. The primer sequences for Gateway recombination are shown in Table 3 (small letters in the primer sequence indicate the changed base for shRNA-resistance).

Transformation of Escherichia coli and plasmid isolation

DNA constructs were mixed with 50 µL of chemically competent DH5α cells, and incubated at 4°C for 30 min. The bacteria were heat shocked at 42°C for 45 sec and incubated at 4°C for 2 min. An amount of 450 µL of LB medium was added and incubated at 37°C for 1 h while shaking. The bacteria were plated onto agar plates supplemented with the appropriate antibiotic and incubated overnight at 37°C.

For plasmid isolation, one colony of transformed bacteria was inoculated into 5 mL (Miniprep) or 250 mL (Maxiprep) LB medium, supplemented with the appropriate antibiotic, and incubated overnight at 37°C while shaking at 200 rpm. Isolation of plasmids was done using QIAprep Miniprep or Maxiprep kits (Qiagen) according to the manufacturer's instructions. Purified plasmids were resuspended in nuclease-free water, and DNA concentration and purity were measured at A_260nm using a DeNovix DS-11 spectrophotometer.

Preparation of whole-cell extracts for activity assays

For tRNA-LC activity assays, cells were scraped with cold PBS and transferred into a tube. After spinning at 1000 rpm, 5 min, 4°C, the supernatant was removed and the cell pellet resuspended in HeLa lysis buffer (10% glycerol, 30 mM HEPES pH 7.4, 5 mM MgCl₂, 100 mM KCl, 1% Nonidet P-40, 0.1 mM AEBSF, 1 mM TCEP pH 7.0). Whole-cell extracts were cleared by centrifugation at 14,8000 rpm, 10 min, 4°C, the supernatant was transferred into a tube, and protein concentration was measured by Bradford assay.

Preparation of extracts for SDS–PAGE

For SDS–PAGE and western blot analysis, cells were scraped with cold PBS and transferred into a tube. After spinning at 1000 rpm, 5 min, 4°C, the supernatant was removed, the cell pellet was resuspended in 5× SDS-loading buffer (62.5 mM Tris pH 6.8, 25 mM EDTA pH 8.0, 5% SDS, 5% β-mercaptoethanol, 0.025% bromophenol blue, 50% glycerol), and diluted with water to obtain 1× SDS-loading buffer. Samples were boiled for 10 min at 95°C and were frozen at −20°C or subjected to protein analysis by SDS–PAGE and western blot.

Determination of protein concentration by Bradford assay

For measurement of protein concentration of whole-cell extracts, Bradford Protein Assay (Bio-Rad, #500-0006) was mixed 1:5 in water. Concentration standards were prepared with bovine serum albumin (BSA, 1 mg/mL) by adding 0, 1, 2, 4, 8, or 16 µL of BSA to 1 mL of Bradford reagent, and a standard curve was prepared by measuring the absorbance at 595 nm. A total of 1 µL of cleared lysate was diluted in 1 mL Bradford reagent, and concentrations were measured at 595 nm based on the standard curve using a DeNovix DS-11 spectrophotometer.

SDS–PAGE and western blot

A total of 25–30 µg of a sample was separated by SDS–PAGE and transferred onto methanol-activated Immuno-Blot PVDF membranes in 1× Turbo Trans-Blot buffer (Bio-Rad, #1704273). Blotting of two membranes was performed at 400 mA for 1 h. Membranes were blocked for 1 h with 5% milk in PBS with 0.05% Tween-20 (PBS-T) or 3% BSA in PBS-T. Blocked membranes were probed with primary antibodies diluted in 5% milk PBS-T or 3% BSA in PBS-T overnight at 4°C while shaking. Membranes were washed three times in PBS-T for 5–10 min and incubated with the appropriate secondary antibody in 5% milk in PBS-T for 1 h at room temperature, before washing three times for 5–10 min in PBS-T. A list of primary and secondary antibodies and their dilutions used in this work can be found in Table 4. Western blots were developed using Clarity or Clarity Max Western ECL substrate (Bio-Rad, #170-5061 and #1705062) and visualized using ChemiDoc Gel Imaging System (Bio-Rad).

RNA isolation and cDNA synthesis

Isolation of RNA from cells was performed using TRIzol reagent (Invitrogen, #15596018) according to the manufacturer's instructions. The obtained RNA pellet was air-dried and resuspended in 20 µL nuclease-free water. Concentration and purity of the sample were measured at A_{260/280 nm} using a DeNovix DS-11 spectrophotometer. Up to 2 µg RNA was treated with DNase to remove genomic DNA. cDNA synthesis from isolated RNA was prepared using Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Thermo Scientific, #K1672), according to the manufacturer's instructions. Obtained cDNA was diluted 1:10 in nuclease-free water before downstream analysis.

Quantitative RT-PCR

For a quantitative measurement of mRNA levels using RT-qPCR, a master mix was prepared for each set of primers: for one well of a 384-well plate, 5 µL of 2× GoTaq (Promega, #A600A), 0.4 µL forward primer (0.5 µM), 0.4 µL reverse primer (0.5 µM), and 3.2 µL nuclease-free water were mixed. A total of 1 µL of cDNA was pipetted into the 384-well plate, and 9 µL master mix was added per well. Primers used in this work can be found in Table 5. The RT-qPCR was performed in CFX384 Touch (Bio-Rad) using the following protocol: 50°C for 10 min, 95°C for 5 min, followed by 60 cycles in total at 95°C for 10 sec and 60°C for 30 sec. The quality of qPCR primers was evaluated by melting curve analysis, and the obtained Ct values were analyzed using the ΔΔCt method.

Semiquantitative RT-PCR

For examination of XBP1u and XBP1s mRNA levels by semiquantitative reverse transcription PCR (RT-PCR), 1 µL of diluted cDNA was mixed with 12.5 µL ReqTaq Ready Mix PCR reaction mix (Sigma Aldrich, #R2523), 0.5 µL forward primer (0.2 µM), 0.5 µL reverse primer (0.2 µM), and filled up to 25 µL with nuclease-free water. The sequences for XBP1 and ACTB forward and reverse primer pairs can be found in Table 6 (Jurkin et al. 2014). DNA amplification was performed at 98°C for 3 min, followed by 27 cycles of 98°C for 30 sec, 55°C for 45 sec, and 72°C for 1 min, and finalized by incubation at 72°C for 10 min. The products of the PCR were run on a 3% agarose gel for 3 h at 50 V and quantified using ImageJ software.

Northern blot analysis

For northern blot analysis of RNA samples, 5 µg of total RNA was mixed with equal volumes of 2× FA buffer (90% formamide, 50 mM EDTA, 1 ng/mL bromophenol blue, 1 ng/mL Xylene Cyanol) and boiled for 5 min at 98°C. Samples were resolved using a 10% denaturing urea polyacrylamide gel (SequaGel, National Diagnostics, #EC-833). After the gel run, the RNA was blotted onto Hybond N+ membranes (Amersham, #RPN303B) for 3 h at 180 mA and cross-linked by UV. Prehybridization was carried out in hybridization buffer (5× SSC, 20 mM Na₂HPO₄ pH 7.2, 7% SDS, and 0.1 mg/mL sonicated salmon sperm DNA [Agilent Technologies, #201190]) at 50°C for 1 h, and hybridization was done at 50°C (DNA probe) or 80°C (LNA probe) overnight in hybridization buffer supplemented with 100 pmol of [5′-³²P] labeled DNA or LNA probes. To obtain the radioactive probe, 1 µL of the respective probe (100 µM) was labeled using 1 µL 10× PNK buffer, 2 µL [γ-³²P]ATP, 1 µL PNK, and 14 µL nuclease-free water. The reaction was incubated for 1 h at 37°C. The labeled probe was separated from unincorporated nucleotides using MicroSpin G-25 columns (GE Healthcare, #GE27-5325-01), according to the manufacturer's instructions. The DNA/LNA probes used for northern blots can be found in Table 7. Blots were washed twice for 1 min with 5× SSC, 5% SDS and once with 1× SSC, 1% SDS at 50°C. The membrane was exposed and visualized by phosphorimaging. For reprobing, membranes were boiled for 5 min in 0.1% SDS and 0.1× SSC, prehybridized and probed with labeled probes as described before. Quantification of band intensities was performed using ImageQuant software (GE Healthcare).

Generation of radiolabeled interstrand RNA substrate

A total of 1.11 MBq [5′-³²P]cytidine-3′,5′-bisphosphate ([³²P]Cp, 111 TBq/mmol, Hartmann Analytic) was ligated to 50 pmol RNA oligonucleotide “20.25” (5′-UCG AAG UAU UCC GCG UAC GU-3′, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16°C in 15% (v/v) DMSO, 50 mM Tris-HCl pH 7.6, 10 mM MgCl₂, 10 mM β-mercaptoethanol, 200 µM ATP, and 0.1 mg/mL BSA in a total reaction volume of 20 µL. Labeling reactions were stopped with equal volumes of 2× FA buffer (90% formamide, 50 mM EDTA, 1 ng/mL bromophenol blue, 1 ng/mL Xylene Cyanol), boiled for 5 min at 98°C, and separated on 10% denaturing urea polyacrylamide gel (SequaGel, National Diagnostics, #EC-833). Labeled RNA was visualized by autoradiography, cut from the gel and passively eluted in 300 mM NaCl, while shaking overnight at 4°C. RNA was precipitated by the addition of three volumes of ice-cold ethanol and recovered by centrifugation. The RNA pellet was resuspended in 200 µL nuclease-free water.

Interstrand ligation assay

Labeled RNA oligonucleotide “20.25” was annealed to nonlabeled complementary RNA oligonucleotide “19.1” (5′-CGU ACG CGG AAU ACU UCG A-3′, Dharmacon, Thermo Scientific) in 30 mM HEPES-KOH pH 7.5, 2 mM MgCl₂, and 100 mM KCl and were heated to 95°C for 2 min and subsequently incubated at 37°C for 1 h. To test for interstrand ligation, 3/5th volumes of a reaction mixture (67 mM KCl, 2 mM MgCl₂, 8.3 mM DTT, 5 mM ATP, 0.3 mM GTP, 53 units/mL RNasin RNase inhibitor, 43% glycerol) containing 17 nM radiolabeled RNA duplex were mixed with 2/5th volumes of cell extracts (protein concentration 5 mg/mL) and incubated at 30°C for 30 min. The reaction was stopped with equal volumes of 2× FA buffer and separated on a 15% denaturing urea polyacrylamide gel. Interstrand ligation products were monitored by phosphorimaging, and band intensities were measured using ImageQuant (GE Healthcare) software and corrected by subtraction of background values.

Pre-tRNA splicing assay

A PCR was performed using S. cerevisiae genomic DNA as template, a 5′ primer including the T7 polymerase promoter (5′-AAT TTA ATA CGA CTC ACT ATA GGG GAT TTA GCT CAG TTG GG-3′), and a 3′ primer (5′-TGG TGG GAA TTC TGT GGA TCG AAC-3′). The PCR product was sequenced and identified as yeast tRNA3-Phe^GAA (chromosome 13). The PCR product served as template for in vitro transcription using the T7 MEGAshortscript Kit (Invitrogen, #AM1354), including 1.5 MBq [α-³²P]guanosine-5′-triphosphate ([α-³²P]-GTP, 111 TBq/mmol, Hartmann Analytic) per reaction. The body-labeled pre-tRNA was resolved on a 10% denaturing urea polyacrylamide gel, visualized by autoradiography and passively eluted from gel slices overnight in 300 mM NaCl. RNA was precipitated by the addition of three volumes of ice-cold ethanol and dissolved to 0.1 μM in buffer containing 30 mM HEPES-KOH pH 7.3, 2 mM MgCl₂, 100 mM KCl. To assess pre-tRNA splicing, one volume of 0.1 μM body-labeled S. cerevisiae pre-tRNA^Phe was preheated at 95°C for 60 sec and incubated for 20 min at room temperature, and subsequently mixed with four volumes of reaction buffer (100 mM KCl, 5.75 mM MgCl₂, 2.5 mM DTT, 5 mM ATP, 6.1 mM Spermidine-HCl pH 8.0 [Sigma Aldrich, #S4139], 100 units/mL RNasin RNase inhibitor [Promega, #N2515]). Equal volumes of this reaction mixture and cell extracts were mixed and incubated at 30°C. At given time points, 5 μL of the mix was deproteinized with proteinase K (Invitrogen, #25530-049), followed by phenol/chloroform extraction and ethanol precipitation. Reaction products were separated on a 10% urea-denaturing polyacrylamide gel, and mature tRNA and tRNA exon formation were monitored by phosphorimaging. Quantification of band intensities was performed using ImageQuant software (GE Healthcare).

Kinetic trapping using FLAG-TRX overexpression cell lines

Trapping of TRX targets using the FLAG-TRX overexpression construct was done as described before (Nakao et al. 2015). HeLa RIEP shTRX cells constitutively overexpressing FLAG-TRX CxxS were seeded into 15 cm² plates, and silencing of endogenous TRX by shRNA was induced with 2 µg/mL Dox for 3 d. Cells were left untreated, stressed for 3 min with H₂O₂, 15 min with menadione, for 4 or 8 h with 1.5 µg/mL Tm or 300 nM Tm. Cells were washed once and scraped in PBS supplemented with 20 mM NEM. After incubation of the cells in PBS with 20 mM NEM for 7 min, cells were pelleted for 5′ at 1000 rpm, and washed with PBS. The cell pellets were lysed in buffer 1 (25 mM TRIS, pH 7.4, 5 mM MgSO₄, 150 mM NaCl, 0.3% Triton X-100) supplemented with cOmplete EDTA-free Protease Inhibitor (Roche, #05056489001) and 20 mM NEM, and incubated for 30 min under slight rotation at 4°C. The lysates were cleared by centrifugation at 14,800 rpm for 10 min, 4°C; protein concentrations were measured by Bradford assay and adjusted to 1–3 mg/mL in 800 µL total volume. A total of 50 µL M2 FLAG-beads (Sigma Aldrich, #A2220-5ML) per 15 cm² plate were washed three times in buffer 1 with 20 mM NEM, and added to the diluted cell lysate. Pulldown of FLAG-TRX variants with trapped proteins was performed for 3 h at 4°C while rotating. Subsequently, beads were washed four times in wash buffer with increasing salt concentrations (buffer 1 with increasing NaCl concentrations: 150 mM NaCl, 250 mM NaCl, 400 mM NaCl, or 500 mM NaCl) and four times in reverse order. Bound complexes were eluted in 50 µL 1 mg/mL FLAG-peptide dissolved in buffer 1 for 30 min, 4°C, while shaking.

Statistical analysis

To assess statistical significance in interstrand ligation assay quantifications, mRNA expression levels (RT-qPCR) or FACS analysis, we used unpaired or paired Student's t-test assuming unequal variances, with (*) P < 0.05; (**) P < 0.01; (***) P < 0.005, using GraphPad Prism software.

Calculation of IC₅₀ values

For the calculation of IC₅₀ values, quantification data from interstrand ligation assays were normalized to the untreated sample of shCtrl cells. IC₅₀ values were calculated by nonlinear regression and sigmoidal concentration–response curve fit using GraphPad Prism software.