Mouse nuclear RNAi-defective 2 promotes splicing of weak 5′ splice sites

Experimental model and subject details

Male mESCs of a mixed 129xC57BL/6 background with a heterozygous integration of only Cre-ERT2 (cMB052) or both Cre-ERT2 and V5-tagged BirA (cMB063) in the Rosa26 locus (Flemr and Bühler 2015; Ostapcuk et al. 2018) were used as parental lines to generate all the genome-edited cell lines used in this study.

Cell culture and treatment

Unless stated otherwise, cells were grown on gelatin-coated dishes in S-L-2i medium (DMEM [Gibco] supplemented with 15% fetal bovine serum [Gibco], 1× nonessential amino acids [Gibco], 1 mM sodium pyruvate [Gibco], 2 mM l-glutamine [Gibco], 0.1 mM 2-mercaptoethanol [Sigma], 50 µg/mL penicillin, 80 µg/mL streptomycin, 1:500 MycoZap Prophylactic [Lonza], homemade LIF conditioned medium, and 2i inhibitors: 3 µM GSK-3 inhibitor XVI [Sigma] and 10 µM MEK inhibitor PD0325901 [Tocris]). To induce conditional knockout of Nrde2 and Mtrex, 4OHT (Sigma; 1:5000 dilution of 0.5 mM stock dissolved in ethanol) was added to the medium and replaced daily for a total of 4 and 3 d, respectively. Depletion of endogenous proteins fused to the 2xHA-FKBP12^F36V domain (dTAG) was achieved by treating the cells with 0.5 µM dTAG-13 compound (Tocris; 1:1000 dilution of 0.5 mM stock solution in DMSO) for 24 h. For chemical inhibition of splicing, cells were treated with 1 µM Thailanstatin A (provided by P. Krastel and M. Frederiksen from Novartis Institutes for BioMedical Research; 1:1000 dilution of 1 mM stock solution in DMSO) for 6 h. To block transcription, cells were treated with 5 µg/mL Actinomycin D (Sigma; 1:1000 dilution of 5 mg/mL stock solution in DMSO) for 2 h. For translation inhibition, 100 µg/mL Cycloheximide (Sigma; 1:1000 dilution of 100 mg/mL stock solution in DMSO) was added for 4 h.

Genome editing

We used both TALEN and Cas9 nucleases to generate cell lines with endogenous gene modifications. Endogenous Nrde2 truncation and point mutation, tagging with 3A tag and loxP site insertions were achieved using single-stranded oligodeoxynucleotides with short homology arms synthesized by Integrated DNA Technologies. Longer inserts flanked by longer homology arms were cloned into pBluescript II KS-plasmid (Agilent Technologies). All TALEN and Cas9 target sequences and donor sequences for homologous recombination are listed in Supplemental Table S1. Cells grown in medium without 2i inhibitors were seeded 5 × 10⁵ per well of a six-well plate and transfected with a mixture of 500 ng of donor DNA and 500 ng of Cas9-2A-Puro/TALEN mix with pRR-Puro reporter (Flemr and Bühler 2015) in Opti-MEM medium (Gibco) using Lipofectamine 3000 (Thermo Fisher Scientific), according to the manufacturer's instructions. The transfected cells were selected by a 24-h treatment with 2 µg/mL puromycin (Sigma) and expanded at a clonal density, and the clones were picked and genotyped by PCR. Correct homozygous insertions were verified by Sanger sequencing.

Growth curve

Cell growth was monitored using the ViaLight Plus Cell Proliferation and Cytotoxicity BioAssay kit (Lonza). Triplicates of 500 cells in 0.5 mL of medium were seeded on a 24-well plate. After 24 h, the medium was removed from the wells of day 0 time point and replaced with 50 µL of PBS. Next, 10 µL of ViaLight cell lysis reagent was added and mixed by pipetting, and the plate was incubated on a rocking platform for 10 min at room temperature. An amount of 10 µL of the lysate was mixed with 10 µL of AMR reagent in a 96-well solid-bottom white assay microplate (Corning) and, after 2-min incubation at room temperature, the luminescence was measured in Mithras LB 940 microplate reader (Berthold Technologies). In the wells of later time points, the medium was replaced 24 h after seeding and every following 24 h with fresh medium with or without 0.1 µM 4OHT. All the later time points were processed for luminescence measurement as described above.

nTAP-MS of 3A-tagged proteins

Each nTAP-MS was performed in three independent replicates. Three near-confluent 10-cm dishes (∼5 × 10⁷ cells) were used per each replicate sample. The dishes were placed on ice, and cells were rinsed with cold PBS and collected by scraping and spinning at 3000g for 2 min at 4°C. The pellets were washed with 0.5% BSA in PBS and then resuspended in 0.5 mL of ice-cold B100 buffer (10 mM Tris-HCl at pH 7.5, 2 mM MgCl₂, 100 mM NaCl, 0.5% Triton X-100) supplemented with 1× Halt Protease Inhibitor Cocktail (HALT) (Thermo Fisher Scientific) and 100 U of Benzonase (Sigma). After 30-min shaking (500 RPM) at 12°C, lysates were diluted with 450 µL of B100 + HALT and centrifuged at 16,000g for 5 min at 4°C.

For each sample, Protein G Dynabeads (Thermo Fisher Scientific) equivalent to 20 µL of the original slurry were resuspended in PBS with 0.02% Tween-20 and coupled with 2 µL of anti-FLAG M2 antibody (Sigma), rotating for 30 min at room temperature. Coupled beads were washed once with PBS + 0.02% Tween-20 and twice with B100. The beads were then resuspended in 50 µL of B100 + HALT, mixed with the cleared lysates, and rotated for 2 h at 4°C. Following three washes with 1 mL of ice-cold B100, FLAG-tagged proteins were eluted by 15-min shaking (500 RPM) in 25 µL of B100 + HALT containing 1 mg/mL 3xFLAG peptide (Sigma) at room temperature. The beads were further rinsed with 425 µL of B100 + HALT, and the supernatant was combined with the 25 µL of eluate from the previous step.

M-280 Streptavidin Dynabeads (Thermo Fisher Scientific) equivalent to 20 µL of the original slurry were prewashed twice with B100, resuspended in 50 µL of B100 + HALT, mixed with the FLAG beads eluates, and rotated for 30 min at room temperature. The beads were then washed three times with 1 mL of B100, resuspended in 0.2 mL of TN buffer (10 mM Tris-HCl at pH 7.5, 100 mM NaCl), and transferred to a new tube. While remaining immobilized on the magnetic stand, the beads were rinsed with an additional 1 mL of TN buffer.

On-bead digestion for mass spectrometry was performed as follows. The washed detergent-free beads were resuspended by vortexing in 5 µL of digestion buffer (8 M urea freshly dissolved in 20 mM HEPES at pH 8.5, 5 mM TCEP, and 10 mM chloroacetamide) and sonicated in Bioruptor Plus (Diagenode) at high energy in 30 cycles, 10 sec ON/10 sec OFF. Next, 1 µL of 0.2 mg/mL LysC protease (Promega) in 50 mM HEPES (pH 8.5) was added, and proteins were predigested for 2 h rotating at room temperature. The urea concentration was then diluted with 17 µL of 50 mM HEPES (pH 8.5) and, after adding 1 µL of 0.2 mg/mL trypsin (Promega) in 0.2 mM HCl, the digestion continued overnight at 37°C with interval mixing at 2000 RPM for 30 sec every 15 min. Digested proteins were then subjected to mass spectrometry as described below in “Mass spectrometry analysis.”

xTAP-MS of 3A-tagged proteins

Each xTAP-MS was performed in three independent replicates. For each replicate sample, cells were harvested by trypsinization, placed on ice, and counted on a Countess II Automated Cell Counter (Thermo Fisher Scientific), and 4.5 × 10⁷ cells were collected by centrifugation at 300g for 2 min and 4°C. The pellets were resuspended in 1.5 mL of room temperature PBS and cross-linking started by the addition of 1.5 mL of 0.2% formaldehyde in PBS. After 10 min rotating at room temperature, 150 µL of 2.5 M glycine was added and samples were placed for 2 min on ice to quench the excess formaldehyde. Cells were pelleted, rinsed with 0.2% BSA in cold PBS, and finally resuspended by vortexing in 180 µL of TMS buffer (10 mM Tris-HCl at pH 8.0, 1 mM MgCl₂, 1% SDS, 1× HALT) prechilled at 12°C and supplemented with 100 U of Benzonase. Following 30-min incubation at 12°C, the lysates were diluted with 1.57 mL of DIL. mix containing a 4:5 (v/v) ratio of H₂O and dilution buffer (20 mM Tris-HCl at pH 8.0, 1 M NaCl, 2% Triton X-100, 20 mM EDTA), supplemented with 1× HALT and incubated for 5 min on ice. Any remaining insoluble material was removed by spinning at 16,000g for 5 min at 4°C.

The cleared lysates were mixed with anti-FLAG antibody-coupled Protein G Dynabeads, which were prepared essentially as described above in the nTAP-MS section, but prewashed with 2 × 1 mL of WASH buffer (10 mM Tris-HCl at pH 8.0, 0.5 M NaCl, 1% Triton X-100, 0.1% SDS, 1 mM EDTA) and resuspended in 50 µL of DIL. mix. After 2 h rotating at 4°C, the beads were washed three times with 1 mL of cold WASH buffer and FLAG-tagged proteins were eluted by shaking at 500 RPM for 15 min in 25 µL of TEDS buffer (10 mM Tris-HCl at pH 8.0, 1 mM EDTA, 10 mM DTT, 1% SDS, 1× HALT) containing 1 mg/mL 3xFLAG peptide at room temperature. The beads were rinsed with another 25 µL of TEDS, and the supernatant was combined with the eluate from the previous step and diluted with 0.4 mL of DIL. mix. Next, M-280 Streptavidin Dynabeads (prewashed twice with 1 mL of WASH buffer and resuspended in 50 µL of DIL. mix) were added and the mixture was rotated for 30 min at room temperature. The beads were washed three times with 1 mL of WASH buffer, resuspended in 100 µL of TEN buffer (10 mM Tris-HCl at pH 8.0, 1 mM EDTA, 150 mM NaCl), and transferred to a new tube. The beads immobilized on the magnetic stand were rinsed with an additional 1 mL of TEN buffer. On-bead protein digestion followed exactly as described above in the nTAP-MS section.

Mass spectrometry analysis

Digested peptides were acidified with 0.8% TFA (final) and analyzed by LC–MS/MS on an EASY-nLC 1000 (Thermo Scientific) with a two-column setup. The nTAP-MS peptides were applied on an Acclaim PepMap 100 C18 trap column (75 µm ID × 2 cm, 3 µm; Thermo Scientific) in 0.1% formic acid and 2% acetonitrile in H₂O at a constant pressure of 80 MPa and separated by a linear gradient of 2%–6% buffer B in buffer A for 3 min, 6%–22% for 40 min, 22%–28% for 9 min, 28%–36% for 8 min, and 36%–80% for 1 min, and 80% buffer B in buffer A for 14 min (buffer A: 0.1% formic acid; buffer B: 0.1% formic acid in acetonitrile) on an EASY-Spray column ES801 (50 µm ID × 15 cm, 2 µm; Thermo Scientific) mounted on a DPV ion source (New Objective) connected to an Orbitrap Fusion (Thermo Scientific) at 150 nL/min flow rate. The xTAP-MS peptides were applied on a µPAC trapping column (PharmaFluidics) in 0.1% formic acid and 2% acetonitrile in H₂O at a constant flow rate of 5 µL/min and separated by a linear gradient of 3%–6% buffer B in buffer A for 4 min, 6%–22% for 55 min, 22%–40% for 4 min, and 40%–80% for 1 min, and 80% buffer B in buffer A for 10 min on a 50-cm µPAC column (PharmaFluidics), mounted on an EASY-Spray source (Thermo Scientific) connected to an Orbitrap Fusion Lumos (Thermo Scientific) at 500 nL/min flow rate. Data were acquired using 120,000 resolution for the peptide measurements in the Orbitrap and a top T (3-sec) method with HCD fragmentation for each precursor and fragment measurement in the ion trap following the manufacturer guidelines (Thermo Scientific).

Peptides were identified with MaxQuant version 1.5.3.8 using the search engine Andromeda (Cox et al. 2011). The mouse subset of the UniProt version 2019_04 combined with the contaminant DB from MaxQuant was searched and the protein and peptide FDR values were set to 0.05. Statistical analysis was done in Perseus version 1.5.2.6 (Tyanova et al. 2016). Results were filtered to remove reverse hits, contaminants and peptides found in only one sample. Missing values were imputed and potential interactors visualized in the volcano plots were determined using a two-sided t-test.

Coimmunoprecipitation with Streptavidin

Cells were seeded 3 × 10⁵ in 2 mL of S-L-2i medium per well of a six-well plate and transfected with a mixture of 200 ng of plasmid DNA, 0.6 µL of Lipofectamine 3000, and 0.4 µL of P3000 reagent in 100 µL of Opti-MEM medium. After 24 h, cells were rinsed twice with ice-cold PBS and lysed directly in the well with 900 µL of co-IP buffer (20 mM Tris-HCl at pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100) supplemented with 1× HALT and, where indicated, also with 1 µL of 10 mg/mL RNase A (Roche). Following 1-h agitation at 4°C, the lysates were collected and centrifuged at 16,000g for 5 min at 4°C. An amount of 2 µL of the cleared supernatants was transferred to a separate tube as the input sample and the rest was mixed with 100 µL of co-IP buffer containing M-280 Streptavidin Dynabeads. Prior to use, the beads (20 µL of the original slurry) were preblocked for 1 h at room temperature in PBS containing 0.5% cold water fish gelatin (Sigma) and 0.02% Tween-20, and washed twice with co-IP buffer. Following 1-h incubation at 4°C, the beads were separated from the lysate and washed four times with 1 mL of co-IP buffer before resuspending in 15 µL of 1× loading buffer (4× NuPAGE LDS sample buffer and 10× NuPAGE sample reducing agent [Thermo Fisher Scientific] diluted to 1× with H₂O). An amount of 13 µL of 1× loading buffer was also added to the input samples. All samples were heated for 3 min at 95°C and subjected to western blotting as described in the Western blotting section below.

Coimmunoprecipitation with anti-m3G antibody

Cells were harvested by trypsinization and counted. For each sample, one million cells were rinsed once with PBS and collected by centrifugation at 200g for 3 min. Cell pellets were resuspended in 1 mL of co-IP buffer supplemented with 1× HALT and incubated for 10 min on ice. The lysates were centrifuged at 16,000g for 5 min at 4°C. An amount of 10 µL of the supernatant was transferred to a separate tube as the input sample and stored at 4°C for the duration of the IP. The remaining supernatant was split in two halves, supplemented with 2 µL of anti-2,2,7-trimethylguanosine (anti-m3G) antibody (Sigma) and 1 µL of either 40 U/µL RNasin RNase inhibitor (Promega) or 10 mg/mL RNase A (Roche), and incubated overnight at 4°C with mixing. The next day, 50 µL of Protein G Dynabeads (equivalent to 20 µL of the original slurry, prewashed twice with 1 mL of co-IP buffer) resuspended in co-IP buffer with 1× HALT was added and incubated for 4 h at 4°C with mixing. Beads were then washed three times with 1 mL of cold co-IP buffer before resuspending in 15 µL of 1× loading buffer. The inputs were mixed with 4 µL of 4× NuPAGE LDS sample buffer and 1.6 µL of 10× NuPAGE sample reducing agent. All samples were heated for 3 min at 95°C and subjected to western blotting as described in the Western blotting section below.

Western blotting

Cells were harvested by trypsinization and counted. One million cells were rinsed once with PBS and collected by centrifugation at 200g for 3 min. Cell pellets were resuspended in 100 µL of TMNS buffer (10 mM Tris-HCl at pH 8.0, 1 mM MgCl₂, 100 mM NaCl, 1% SDS) containing 25 U of Benzonase and incubated for 5 min at room temperature. An amount of 10 µL of the resulting lysate was mixed with 4 µL of 4× NuPAGE LDS sample buffer and 1.6 µL of 10× NuPAGE sample reducing agent, incubated for 3 min at 95°C and loaded on NuPAGE 4%–12% Bis-Tris Mini Protein Gel (Thermo Fisher Scientific). Proteins were separated by electrophoresis in NuPAGE MOPS SDS running buffer and transferred in Bjerrum and Schafer-Nielsen transfer buffer (48 mM Tris, 39 mM glycine, 20% methanol) onto Immobilon-P PVDF membrane (Millipore), using Trans-Blot SD Semi-Dry Transfer Cell (Bio-Rad) at a constant 15 V for 15 min, followed by a constant 25 V for 25 min. We note that for full-length NRDE2, using the rapid Trans-Blot Turbo Transfer System (Bio-Rad) resulted in suboptimal transfer that cannot be explained by the protein size. For visualization of biotinylated proteins, the membrane was blocked for 15 min at room temperature in TBST containing 1% BSA before adding HRP-Streptavidin (Sigma) to 1:20,000 dilution and incubating for a further 30 min. The membrane was washed three times (5 min each) with TBST, rinsed with PBS, and the proteins were visualized with Immobilon Western Chemiluminescent HRP substrate (Merck/Millipore; used at 1:1:3 [H₂O] dilution) using Amersham Imager 600 (GE Healthcare). For antibody-based western blotting, the membrane was blocked for 10 min at room temperature in TBST containing 1% nonfat dry milk (TBST-NFDM) and then incubated with primary antibody diluted in TBST-NFDM with 0.05% NaN₃ overnight at 4°C. The membrane was washed three times (5 min each) with TBST and incubated for 1 h at room temperature with HRP-conjugated secondary antibody diluted 1:10,000 in TBST-NFDM. After that, the membrane was washed, and the signal was developed as described above. When reprobing the same membrane with a different antibody, the membrane was stripped twice for 5 min in 25 mM glycine (pH 2.0), with the first incubation supplemented with 1% SDS, before rinsing thoroughly with water and repeating the blocking and antibody incubations as described above.

Yeast two-hybrid screen

The Y2H screen was performed as a commercial service by Hybrigenics S.A. A bait cDNA of full-length mouse Nrde2 (encoding amino acids 2–1172) was probed against Mouse Embryonic Stem Cell_RP1 cDNA library with a total of 58.2 million interactions tested. Gene Ontology terms of 87 high-confidence interactors (PBS score A–D) were analyzed using the clusterProfiler R package (Yu et al. 2012).

Live-cell imaging

Ibidi µ-Slide 8-well chambers were coated with 10 µg/mL Biolaminin LN-511 (BioLamina) diluted in PBS with 1 mM CaCl₂ and 0.5 mM MgCl₂ overnight at 4°C. Coated wells were rinsed with PBS and immediately filled with S-L-2i medium to which 4 × 10⁴ to 6 × 10⁴ cells were plated. Cells were imaged 24 h after seeding on a Nikon Ti2-E Eclipse inverted microscope equipped with a Yokogawa CSU W1 spinning disk confocal scanning unit, two back illuminated EMCCD iXon-Ultra-888 (Andor) cameras and CFI Plan Apochromat Lambda 100×/1.45 oil immersion objective (Nikon). Fluorescence was excited with 488-nm iBeam Smart (Toptica) and 561-nm Cobolt Jive (Cobolt) lasers, and images (pixel size 0.13 µm) were acquired using VisiView software (Visitron Systems GmbH) with the following settings: 100% laser intensity, 500-msec exposure time, EMCCD GAIN 100 for all mNeonGreen-tagged proteins and 25% laser intensity, 200-msec exposure time, EMCCD GAIN 100 for mCherry-U2AF2. The cells were kept at 37°C and 5% CO₂ during all treatments and imaging.

BCLIP-seq of 3A-tagged proteins

For each BCLIP-seq sample, 1.5 × 10⁷ cells were seeded on a 10-cm dish 24 h before cross-linking. For low-abundant proteins, two or four dishes were seeded per sample and processed separately until pooling two at a time during the last FLAG beads wash and, when starting with four dishes, during the last Streptavidin beads wash as described below. Cells were rinsed once on ice and then covered with 5 mL of cold PBS. Open dishes without a lid were placed on an ice-cold aluminum plate in Stratalinker 2400 (Stratagene), and 254 nm UV light was applied for 30 sec to cross-link the protein–RNA interactions. After cross-linking, PBS was removed, cells were scraped in 2 × 0.9 mL of 0.2% BSA in cold PBS and pelleted by spinning at 3000g for 2 min at 4°C. Pellets were resuspended by vortexing in 100 µL of TMS buffer (as in xTAP-MS) prechilled at 12°C and supplemented with 100 U of Benzonase. Following 30-min incubation at 12°C, the lysates were diluted with 0.85 mL of DIL. mix (as in xTAP-MS) and incubated for 5 min on ice. Any remaining insoluble material was removed by spinning at 16,000g for 5 min at 4°C.

The cleared lysates were mixed with anti-FLAG antibody-coupled Protein G Dynabeads resuspended in 50 µL of DIL. mix (as in xTAP-MS) and incubated for 2 h rotating at 4°C, followed by washes, 3xFLAG peptide elution, and incubation with M-280 Streptavidin Dynabeads exactly as described above for xTAP-MS. The Streptavidin beads were washed three times with 1 mL of WASH buffer, once with 0.2 mL of 1× PAP buffer (50 mM Tris-HCl at pH 8.0, 250 mM NaCl, 10 mM MgCl₂, 0.02% Tween-20) and transferred in 0.1 mL of 1× PAP to a 0.2-mL PCR tube.

The purified cross-linked RNA fragments were polyadenylated by resuspending the beads in 20 µL of 1× PAP buffer containing 0.1 mM ATP and 2.5 U Escherichia coli Poly(A) polymerase (NEB), and incubating for 10 min at 37°C with interval mixing (2000 RPM for 15 sec every 3 min). The reaction was stopped by adding 180 µL of TES buffer (10 mM Tris-HCl at pH 8.0, 1 mM EDTA, 2% SDS) and the beads were washed two more times with 0.2 mL of TES before resuspending in 20 µL of TET buffer (10 mM Tris-HCl at pH 8.0, 1 mM EDTA, 0.5% Triton X-100) with 0.5 µL of 20 mg/mL Proteinase K (Roche). After 30 min of protein digestion at 50°C with interval mixing, Proteinase K was inactivated for 3 min at 85°C. The beads were separated on a magnet, and the supernatant was transferred to a new tube and mixed with 20 µL of homemade SPRI beads (equivalent of 1 mL of Sera-Mag Magnetic SpeedBeads, carboxylated, 1-µm 3 EDAC/PA5 [GE Healthcare Life Sciences] in 50 mL of binding buffer containing 10 mM Tris-HCl at pH 8.0, 1 mM EDTA, 2.5 M NaCl, 20% PEG8000, 0.05% Tween-20, and 0.05% NaN₃) and 40 µL of isopropanol. RNA was precipitated rotating for 10 min at room temperature, beads were separated and rinsed on a magnet twice with 0.2 mL of 80% ethanol and dried for 1 min, and finally RNA was eluted in 15.25 µL of 0.02% Tween-20.

The purified RNA was mixed with 1 µL of 0.2 µM RA3dT18V primer and 1 µL of 10 mM dNTPs (10 mM each dATP, dCTP, dGTP, dTTP), denatured for 3 min at 65°C, and quickly cooled on ice. Reverse transcription was started by mixing with a master mix consisting of 2 µL of 10× RT buffer (500 mM Tris-HCl at pH 8.3, 750 mM KCl, 30 mM MgCl₂, 20 mM TCEP), 0.5 µL of RNase Block (Agilent), and 0.25 µL of SuperScript II (Thermo Fisher Scientific) and incubating for 15 min at 42°C, after which 1 µL of 40 mM MnCl₂ and 1µL of 20 µM TSO were added, and the 42°C incubation continued for another 30 min followed by a 15-min heat inactivation at 70°C. The reaction was slowly cooled down to room temperature with a Δ −1°C/sec gradient, and 0.5 µL each of 5 U/µL RNase H (NEB), 1000 U/µL RNase T1 (Thermo Fisher Scientific), and 20 U/µL Exonuclease I (NEB) were added to degrade the excess TSO and RT primer for 20 min at 37°C, followed by a 15-min heat inactivation at 80°C. The resulting cDNA was purified by isopropanol precipitation on SPRI beads as described above and eluted in 17.2 µL of 0.02% Tween-20.

To amplify the cDNA library, the eluates from the previous step were transferred to a 0.2-mL low-profile PCR tube (Bio-Rad) and mixed with a master mix consisting of 20 µL of 2× NEBNext Ultra II Q5 Master Mix (NEB), 1 µL of 40 µM P5* primer, 1 µL of 40 µM PE* primer, and 0.8 µL of 100 µM EvaGreen Fluorescent DNA Stain (Jena Bioscience). The reactions were amplified in a CFX96 Real-Time PCR instrument (Bio-Rad) with an initial denaturation for 45 sec at 98°C, followed by cycles of 10 sec at 98°C and 50 sec at 65°C, plate read, and10 sec at 65°C. The amplification was monitored in real time, and the reactions were removed after three cycles of exponential fluorescence signal increase (typically between 12 and 18 total cycles). The amplified library was purified by mixing with 32 µL of homemade SPRI beads and incubating for 5 min at room temperature. The beads were then separated and rinsed on a magnet twice with 0.2 mL of 80% ethanol and dried for 1 min, and DNA was eluted in 20 µL of H₂O. Equal amounts of libraries generated with different barcode TSOs were pooled together and sequenced on the Illumina HiSeq2500 platform (50-nt single-end reads).

All BCLIP-seq related oligonucleotides were ordered as standard desalted RNA/DNA oligos or ultramers from IDT and their sequences are listed in Supplemental Table S3.

RNA-seq

Total RNA was isolated from near-confluent 6-cm dishes using the Absolutely RNA Miniprep kit (Agilent), including an on-column DNase treatment step, according to the manufacturer's instructions. Libraries were prepared using the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina), including a ribosomal RNA depletion step, and sequenced on the Illumina HiSeq2500 platform (50-nt single-end reads).

Quantitative RT-PCR

Total RNA was isolated as described in the RNA-seq section and 500 ng was reverse-transcribed using the PrimeScript RT Master Mix (Takara). A volume of cDNA corresponding to 5 ng of the input RNA was subjected to quantitative PCR (qPCR) in a 10-µL reaction using the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) and 0.4 µM each forward and reverse primer. The qPCR was performed in a CFX96 Real-Time PCR instrument (Bio-Rad) with an initial denaturation for 30 sec at 95°C, followed by 40 cycles of 5 sec at 95°C,10 sec at 60°C, and plate read. The relative RNA levels were determined using the ΔΔC_t method and normalized to Actb expression. All qPCR primer sequences are listed in Supplemental Table S4.

RT-PCR of splicing isoforms

For the splicing analysis of endogenous transcripts, cells were grown to near confluency on 6-cm dishes and total RNA was extracted using the RNAzol RT reagent (Sigma) following the manufacturer's protocol. An amount of 1 µg of the RNA was reverse-transcribed in a 10-µL reaction using SuperScript IV (Thermo Fisher Scientific) and random primers (Agilent), and a volume of cDNA corresponding to 5 ng of the input RNA was subjected to 30 cycles of PCR with the 2× NEBNext Ultra II Q5 Master Mix (NEB).

To determine the splicing pattern of the luciferase reporter transcripts, 2 × 10⁵ wild-type cells or 4 × 10⁵ Nrde2-KO cells (2 d of 4OHT treatment) were seeded on a six-well plate, transfected with 500 ng of the corresponding reporter plasmid DNA using Lipofectamine 3000, and grown for 48 h. Cells were harvested in 0.5 mL of RNAzol RT reagent supplemented with 1 µL of Polyacryl Carrier (MRC), and total RNA was extracted following the manufacturer's protocol. An amount of 500 ng of the RNA was treated with ezDNase (Thermo Fisher Scientific) and reverse transcribed using SuperScript IV and random primers. A volume of cDNA corresponding to 2.5 ng of the input RNA was subjected to 35 cycles of PCR with the 2× NEBNext Ultra II Q5 Master Mix (NEB).

The PCR reactions were purified using homemade SPRI beads (as described in the BCLIP-seq section), resolved on a 1% agarose gel containing Midori Green Advance stain (Nippon Genetics) and visualized using the FastGene FAS-DIGI PRO gel imaging system (Nippon Genetics). The sequences of primers used for splicing pattern analysis are listed in Supplemental Table S4.

Ribo-seq

For each Ribo-seq sample, 2 × 10⁶ cells (3 d of 4OHT treatment for Nrde2-KO cells) were seeded on a 6-cm dish and grown overnight. Cells were rinsed and scraped in 2 × 0.5 mL of cold PBS on ice and pelleted by spinning at 3300g for 2 min at 4°C. The pellet was resuspended by pipetting in 0.2 mL of Ribo-seq buffer (25 mM HEPES-KOH at pH 7.5, 200 mM KOAc, 2 mM MgCl₂, 1% NP-40) and incubated for 5 min on ice, followed by spinning at 7600g for 5 min at 4°C. An amount of 100 µL of the supernatant was transferred to a new tube, mixed with 100 µL of H₂O and 0.4 µL of 250 U/µL Benzonase, and incubated for 30 min at 37°C with constant shaking. The nuclease digestion was stopped by adding 0.5 mL of RNAzol RT reagent with 1 µL of Polyacryl Carrier, and RNA fragments were purified following the manufacturer's total RNA isolation protocol. The precipitated RNA was resuspended in 5 µL of H₂O, mixed with 5 µL of 2× Novex TBE-Urea sample buffer (Thermo Fisher Scientific) and denatured for 3 min at 70°C. RNA was resolved on a Novex 15% TBE-Urea gel (Thermo Fisher Scientific) in 1× TBE buffer for 75 min at 180 V side by side with 20 ng of a 35-nt-long single-stranded DNA oligo 5′-ACCACTCGAGTCAAAACAGAGATGTGTCGAAGATG-3′ (IDT). The gel was stained in 20 mL of 1× TBE buffer containing 2 µL of SYBR Gold stain (Thermo Fisher Scientific) for 5 min at room temperature, and a band migrating just above the 35-nt oligo was cut from the Ribo-seq sample lane.

The gel piece was submerged in 100 µL of 400 mM NaOAc (pH 5.2) and frozen at −80°C. After thawing the gel-containing tube for 5 min at 95°C, the gel piece was crushed with a plastic pestle, 300 µL of 400 mM NaOAc (pH 5.2) was added, and RNA was extracted from the gel by three cycles of 5-min incubation at 95°C and 20-min shaking at 22°C. The mixture was cleared by spinning through a Corning Costar Spin-X filter (0.45-µm cellulose acetate; Sigma) at 20,000g for 5 min at room temperature. RNA was precipitated by adding 1 µL of glycogen (Roche) and 1 mL of ethanol to the flow-through and incubating for 1 h at −20°C. RNA was pelleted by spinning at 16,000g for 15 min at 4°C, and the pellet was washed twice with 0.5 mL of cold 80% ethanol, dried for 5 min at room temperature, and finally resuspended in 10 µL of C1 buffer (10 mM Tris-HCl at pH 7.5, 1 mM EDTA, 1 M NaCl, 0.02% Tween-20).

Before the next step, custom Ribo-beads were prepared as follows. Streptavidin MyOne C1 Dynabeads (Thermo Fisher Scientific) equivalent to 20 µL of the original slurry were washed twice with 0.2 mL of C1 buffer and resuspended in 20 µL of C1 buffer. Two rRNA depletion oligos were ordered from IDT as 3′-biotinylated standard desalted custom DNA oligos CCGTACGCCACATTTCCCACGCCGCGACGCGC/3BioTEG/ and CAAGACGAACGGCTCTCCGCACCGGACCCCGGTCCC/3BioTEG/, resuspended, and mixed to 50 µM each. Before the first use, the mixture was denatured for 1 min at 95°C and quickly cooled on ice. An amount of 2 µL of the rRNA depletion oligo mix was added to the 20 µL of C1 Dynabeads and incubated for 15 min at room temperature with occasional mixing. The beads were washed twice with 0.2 mL of C1 buffer and resuspended in 20 µL of C1 buffer.

The purified RNA fragments were mixed with 10 µL of the Ribo-beads and incubated for 3 min at 70°C, followed by 10 min at 50°C. Beads were separated on a magnet, and the supernatant was mixed with the remaining 10 µL of the Ribo-beads. After another round of 3 min at 70°C and 10 min at 50°C, the supernatant was mixed with 30 µL of homemade SPRI beads (as in BCLIP-seq) and 50 µL of isopropanol, and the RNA was precipitated rotating for 10 min at room temperature. The beads were separated, rinsed on a magnet twice with 0.2 mL of 80% ethanol, and dried for 1 min, and finally RNA was eluted in 13.5 µL of 0.02% Tween-20.

The purified rRNA-depleted RNA fragments were polyadenylated by adding 4 µL of 5× PAP buffer (as in BCLIP-seq), 2 µL of 1 mM ATP, and 0.5 µL of 5 U/µL E. coli Poly(A) polymerase (NEB) and incubated for 10 min at 37°C with interval mixing (2000 RPM for 15 sec every 3 min). The reaction was stopped by the addition of 20 µL of homemade SPRI beads and 40 µL of isopropanol. Subsequent polyadenylated RNA purification, reverse transcription with template switching, cDNA library amplification, and sequencing on Illumina HiSeq2500 were performed exactly as described in the BCLIP-seq section.

Flow cytometry

Cells from a near-confluent six-well plate were harvested by trypsinization and pelleted by spinning at 300g for 2 min. The pellets were washed once and resuspended in cold PBS. The mNeonGreen fluorescence of the endogenously expressed 2C reporter was measured on a BD LSR II flow cytometer (BD Biosciences) using a 488 nm excitation laser and a FITC filter. The acquired data were analyzed using the FlowJo software.

Luciferase reporter assays

The backbone control luciferase reporter plasmid was created by placing the Renilla and Firefly luciferase coding sequences with SV40 and BGH polyA sites, respectively, under the control of a minimal endogenous bidirectional promoter driving the expression of mouse Emg1 and Phb2 genes, into the pBluescript II KS-plasmid (Agilent Technologies). For in-frame fusion with Cdk2 and Tti1 fragments, a P2A self-cleaving peptide sequence was included to separate the Renilla luciferase. Site-directed mutagenesis was performed by PCR with NEBNext High-Fidelity 2× PCR master mix (NEB) using overlapping primers with 15-nt overhangs carrying the desired mutation (IDT).

Cells were seeded 2 × 10⁵ to 6 × 10⁵ per well of a 96-well plate and transfected with 10 ng of the corresponding reporter plasmid supplemented with 90 ng of pBluescript II KS, using Lipofectamine 3000. Nrde2-KO cells were treated with 4OHT for 2 d prior to transfection. Where appropriate, the cells were treated with the dTAG-13 compound 24 h post-transfection. After 48 h post-transfection, cells were washed with PBS and lysed in 25 µL of Passive Lysis Buffer (Promega) for 20 min at room temperature. An amount of 10 µL of the lysate was used to measure luciferase activity by sequential mixing with 10 µL of each substrate from the Dual-Luciferase Reporter Assay System (Promega). Luminescence was measured on a Mithras LB 940 microplate reader (Berthold Technologies). All Renilla luminescence values were first normalized to Firefly and the normalized activity was then calculated relative to the empty control reporter in wild-type cells.

RNA immunoprecipitation followed by northern blotting

Cells were harvested by trypsinization and counted. For each sample, 5 × 10⁷ cells were collected by centrifugation at 300g for 2 min and rinsed once with 1 mL of PBS. Cell pellets were resuspended in 1 mL of cold co-IP buffer (20 mM Tris-HCl at pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100) supplemented with 1× HALT in a 15-mL Bioruptor tube containing one scoop of sonication beads (Diagenode) and sonicated in Bioruptor Pico (Diagenode) in five cycles of 30 sec ON/30 sec OFF. Lysates were cleared by centrifugation at 16,000g for 5 min at 4°C, and 1 µL of the supernatant was taken to a separate tube as 0.1% input. The remaining supernatant was mixed with anti-FLAG antibody-coupled Protein G Dynabeads (prepared as described above in the nTAP-MS section, but prewashed with 2 × 1 mL of co-IP buffer and resuspended in 50 µL of co-IP buffer with 1× HALT). After 2 h rotating at 4°C, the beads were washed three times with 1 mL of cold co-IP buffer, and FLAG-tagged proteins were eluted by two consecutive 15-min incubations with shaking (500 RPM) at room temperature—first in 100 µL of co-IP buffer with 1× HALT containing 0.25 mg/mL 3xFLAG peptide, and second in 25 µL of co-IP buffer with 1× HALT containing 1 mg/mL 3xFLAG peptide. The beads were rinsed with another 325 µL of co-IP buffer, and the supernatant was combined with the eluates from the previous step. M-280 Streptavidin dynabeads (prewashed twice with 1 mL of co-IP buffer) resuspended in 50 µL of co-IP buffer with 1× HALT were then added, and the samples were incubated for 30 min at room temperature with mixing. Beads were washed on ice three times with 1 mL of cold co-IP buffer and resuspended in 0.5 mL of RNA extraction buffer (10 mM Tris-HCl at pH 8.0, 10 mM EDTA, 1% SDS, 350 mM NaCl, 7 M Urea), which was also added to the inputs. RNA was extracted by adding 0.5 mL of buffered phenol:chloroform:IAA (pH 8.0; Sigma) and shaken for 1 min, followed by spinning at 20,000g for 5 min at room temperature. The upper phase was transferred to a new tube, and RNA was precipitated by mixing with an equal volume of isopropanol in the presence of 1 µL of Polyacryl Carrier (MRC). After 10-min incubation at room temperature, RNA was pelleted by centrifugation at 16,000g for 30 min at 4°C, washed once with 0.5 mL of 75% ethanol, air-dried for 5 min, and resuspended in 5 µL of water. Next, 5 µL of 2× Novex TBE-Urea Sample Buffer (Thermo Fisher Scientific) was added, and samples were denatured for 3 min at 95°C and immediately cooled on ice. RNA was separated on a 6% Novex TBE-Urea gel (Thermo Fisher Scientific) for 70 min at 90 V in 1× TBE buffer preheated to 50°C. The gel was briefly rinsed with 1× TBE, and RNA was transferred to positively charged Nylon membrane (Roche) using Fastblot (Biometra) for 30 min at a constant current of 200 mA. After the transfer, RNA was cross-linked to the wet membrane for 90 sec using Stratalinker 2400. The membrane was air-dried, washed in 2× SSC buffer containing 0.1% SDS, and prehybridized in 10 mL of ULTRAhyb-Oligo buffer (Thermo Fisher Scientific) for 90 min at 37°C. Twenty picomoles of a 3′-end biotinylated ssDNA oligo (GTATCTCCCCTGCCAGGTAAGTAT/Bio/ for U1 snRNA and TACTGCAATACCAGGTCGATGCGT/Bio/ for U2 snRNA) (Ishikawa et al. 2014) was then added and hybridized overnight at 37°C. The membrane was washed three times for 15 min with 50 mL of prewarmed 2× SSC buffer containing 0.5% SDS at 37°C, and the biotin signal was detected with a Chemiluminescent Nucleic Acid Detection Module kit (Thermo Fisher Scientific) following the manufacturer's instructions. The signal was visualized using Amersham Imager 600 (GE Healthcare).

Quantification and statistical analysis

Analysis of 5′ splice site-overlapping BCLIP-seq reads

The regions ±100 bp around 5′SSs of introns >1 kb were selected. Those with less than 50 BCLIP-seq reads (in total over all samples) were removed. Each BCLIP-seq .bam file was loaded using RSamtools R package, and the reads that overlap 5′SSs were selected. Spliced or unspliced reads were counted separately for each junction and each sample .bam file. Then the 5′SSs with spliced and unspliced read counts above 10 were selected, and the fold change between spliced and unspliced read counts was calculated.