HBS and ABS function together to modulate distal 5′ splice site usage. (A) Sequence of ABS and structure of the 553 splicing units containing HBS1, HBS3, HBS4, and ABS. (B) The pre-mRNAs were incubated in HeLa nuclear extract. Pre-mRNAs and splicing products were amplified by RT-PCR. For each reaction, the percentage of proximal product is indicated in the graph. (C) In vitro splicing assays in the presence of 2 pmol of DNA oligo HUMMK containing hnRNP H binding sites (CCATGGTTTGGGAGTGGGAAGGTGGGGAG) and 2 pmol of DNA oligo TS10 carrying hnRNP A1 binding sites [(TTAGGG)10]. The sum of the activity of one binding site for hnRNP H or hnRNP A1 at both positions was less than the activity of a combination of hnRNP H and hnRNP A1 binding sites.
