Characterization of a thermostable archaeal polynucleotide kinase homologous to human Clp1

(Downloading may take up to 30 seconds. If the slide opens in your browser, select File -> Save As to save it.)

Click on image to view larger version.

FIGURE 2.
FIGURE 2.

Polynucleotide kinase activity of PhoClp1. (A) PhoClp1 purification. Aliquots (3 μg) of tag-free wild-type PhoClp1 and the K49A and D73A mutants were analyzed by SDS-PAGE. The Coomassie blue stained gel is shown. The positions and sizes (kDa) of marker polypeptides are indicated on the left. The major 41 kDa polypeptide corresponds to tag-free PhoClp1. We did not attempt to identify the 28 kDa polypeptide, although we know it does not correspond to either the cleaved His10Smt3 tag or the Ulp1 protease, which migrate differently during SDS-PAGE. The 28-kDa species was itself generated by Ulp1 cleavage of a larger polypeptide recovered during the first Ni-agarose purification step. Thus, we surmise that the 28-kDa species is probably an N-terminal fragment of Clp1. (B) Kinase activity. Reaction mixtures (10 μL) containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 500 μM [γ32P]ATP, 5 μM 24-mer 5′-OH DNA d(CACTATCGGAATAAGGGCGACACG), and wild-type or mutant PhoClp1 as specified were incubated for 15 min at 55°C. The extent of DNA phosphorylation is plotted as a function of input PhoClp1. Each datum is the average of three separate titration experiments. Error bars denote the standard deviation. (C) Kinetics. Reaction mixtures (70 μL) containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 500 μM [γ32P]ATP, 5 μM 24-mer 5′-OH DNA and either 45, 90, or 180 nM PhoClp1 as specified were incubated at 55°C. Aliquots (10 μL, containing 50 pmol of DNA ends) were withdrawn at the times specified and quenched immediately with EDTA/formamide. (D) ATP titration. Reaction mixtures (10 μL) containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 5 μM 24-mer 5′-OH DNA, 0.45 pmol PhoClp1, and [γ32P]ATP as specified were incubated for 10 min at 55°C. The extent of DNA phosphorylation is plotted as a function of ATP concentration. Each datum is the average of three separate titration experiments. Error bars denote the standard deviation. K m and k cat were calculated in Prism by nonlinear regression curve fitting of the experimental data.

This Article

  1. RNA 15: 923-931