The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA
Abstract
A2503 in 23S rRNA of the Gram-negative bacterium Escherichia coli is located in a functionally important region of the ribosome, at the entrance to the nascent peptide exit tunnel. In E. coli, and likely in other species, this adenosine residue is post-transcriptionally modified to m2A. The enzyme responsible for this modification was previously unknown. We identified E. coli protein YfgB, which belongs to the radical SAM enzyme superfamily, as the methyltransferase that modifies A2503 of 23S rRNA to m2A. Inactivation of the yfgB gene in E. coli led to the loss of modification at nucleotide A2503 of 23S rRNA as revealed by primer extension analysis and thin layer chromatography. The A2503 modification was restored when YfgB protein was expressed in the yfgB knockout strain. A similar protein was shown to catalyze post-transcriptional modification of A2503 in 23S rRNA in Gram-positive Staphylococcus aureus. The yfgB knockout strain loses in competition with wild type in a co-growth experiment, indicating functional importance of A2503 modification. The location of A2503 in the exit tunnel suggests its possible involvement in interaction with the nascent peptide and raises the possibility that its post-transcriptional modification may influence such an interaction.
Keywords
INTRODUCTION
Ribosomal RNA plays a critical role in protein synthesis. In the ribosome, rRNA adopts an intricate spatial structure that places chemical groups of rRNA nucleotides in the proper position for carrying out such elaborate functions as monitoring codon–anticodon interactions, catalyzing peptide bond formation, binding ligands and cofactors, etc. In vitro transcribed rRNA can be assembled into small and large ribosomal subunits and can carry out protein synthesis reasonably well, suggesting that the main functional properties of rRNA are dictated solely by its nucleotide sequence and spatial arrangement (Krzyzosiak et al. 1987; Green and Noller 1999; Khaitovich et al. 1999). Yet in the cell, rRNA carries a number of post-transcriptional modifications at specific nucleotide residues. The clustering of the modified nucleotides in functionally critical regions of rRNA indicate their importance for ribosome activity (Ofengand and Fournier 1998). However, with a few exceptions, the exact role of these modified nucleotides remains largely unknown. Analyzing functional properties of the ribosome lacking individual modifications is the most direct way to elucidate the contribution of post-transcriptional modifications to translation. For that, one needs to know the enzymes that alter the chemical nature of rRNA nucleotides.
In bacteria, rRNA modifications involve mainly methylation of various rRNA residues and pseudouridylation. In the case of Escherichia coli 23S rRNA, 25 modified nucleotides have been mapped (Andersen and Douthwaite 2006). Fourteen of these modifications are associated with domain V, the main component of the peptidyl transferase center (PTC) (Fig. 1; Noller 1984). The pseudouridine synthases responsible for all five pseudouridine modifications in this region (positions 2457, 2504, 2580, 2604, and 2605) have been identified (Conrad et al. 1998; Huang et al. 1998; Del Campo et al. 2001). Of the 9 remaining modified nucleotides, 7 carry methylations (m6A2030, m7G2069, Gm2251, m2G2445, Cm2498, m2A2503, and Um2552), one is a dihydrouridine (D2449), and one is a predicted 2-thiocytidine (s2C2501) (Andersen et al. 2004). So far, only three of the methyltransferases responsible for post-transcriptional methylation of nucleotides in domain V of 23S rRNA have been identified—RlmE (synonymous to FtsJ or RrmJ), which generates 2′-O-methylated uridine at position 1552 (Bugl et al. 2000; Caldas et al. 2000), RlmL (synonymous to YcbY), which methylates the N2 position of G2445 (Lesnyak et al. 2006), and RlmB (synonymous with YifH), which generates 2′-O-methyl guanine at position 2251 (Lövgren and Wikström 2001).
Secondary structure of domain V of E. coli 23S rRNA (Cannone et al. 2002). The sites of post-transcriptional modification are indicated. Green: nucleotides that carry methylations; blue: pseudouridines, dihydoruridine, or 2-thiocytidine. m2A2503 is circled and in red. A DNA oligonucleotide used to prepare a fragment of 23S rRNA for the nucleotide analysis is shown by a solid line.
One of the methylated nucleotides in the PTC is A2503. In E. coli, A2503 is post-transcriptionally modified to m2A (Kowalak et al. 1995). A2503 is located at the entrance of the exit tunnel (Ban et al. 1998; Harms et al. 2001; Schuwirth et al. 2005; Selmer et al. 2006); however, the precise functional role of m2A2503 has not been explored. This nucleotide is fairly close to the binding sites of several PTC-targeting antibiotics, including clindamycin, carbomycin, streptogramin A, anisomycin, and linezolid (Schlunzen et al. 2001; Hansen et al. 2002; Tu et al. 2005). Mutations of A2503 confer resistance to chloramphenicol and streptogramins (Vester and Garrett 1988; Porse and Garrett 1999) and its hypermethylation by Cfr methyltransferase in staphylococci or E. coli leads to resistance against a number of PTC-targeting antibiotics (Kehrenberg et al. 2005; Long et al. 2006).
Here, we report the identification of the methyltransferase, RlmN, which is responsible for generation of m2A2503 in the ribosomes of Gram-positive and Gram-negative bacteria.
RESULTS
The E. coli gene yfgB encodes an enzyme responsible for methylation of A2503 in 23S rRNA
S-adenosylmethionine- (SAM) dependent methyltransferase Cfr, whose gene was found in staphylococcal isolates from animal sources and more recently in a clinical strain of Staphylococcus aureus, confers resistance to a number of PTC-targeting inhibitors of protein synthesis (Kehrenberg et al. 2005; Long et al. 2006; Toh et al. 2007). Cfr-mediated antibiotic resistance results from hypermethylation of A2503 in 23S rRNA. Sequence analysis of the staphylococcal cfr gene showed its significant homology (32% sequence identity) with an E. coli gene yfgB that encodes a protein of unknown function (Schwarz et al. 2000; Kozbial and Mushegian 2005). Similar to Cfr, YfgB contains the cysteine-rich motif C124ALECKFC, which is a characteristic signature of the superfamily of proteins known as radical SAM enzymes (motif 1 in Fig. 2; Schwarz et al. 2000). Importantly, homology between Cfr and YfgB extends into the C-terminal portion of the protein, which in radical SAM enzymes is often responsible for substrate binding, suggesting that Cfr and YfgB may operate upon the same or similar substrates. Therefore, we hypothesized that E. coli yfgB could encode the elusive methyltransferase responsible for natural modification of A2503 in the 23S rRNA of E. coli to m2A.
Alignment of RlmN (YfgB) (E. coli) with similar proteins from Gram-negative bacteria (magenta), Gram-positive bacteria (cyan), and unicellular eukaryotes (orange). Residues with high consensus score (>90%, red; >50%, blue) are highlighted. The six conserved motifs of radical SAM enzymes are indicated (Schwarz et al. 2000; Kozbial and Mushegian 2005). Alignment was done using MultAlin server (http://bioinfo.genopole-toulouse.prd.fr/multalin/multalin.html) (Corpet 1988).
To test this hypothesis we used the strain JW2501 from the “Keio” collection of E. coli clones containing single-gene knockouts of all nonessential genes in the E. coli K-12 strain BW25113 (Baba et al. 2006). In strain JW2501 of the collection, the kanamycin resistance cassette replaced the yfgB gene. Inactivation of the yfgB gene in strain JW2501 was confirmed by PCR.
The modification status of A2503 in the JW2501 strain was initially analyzed by primer extension. In wild-type E. coli, the methylation of A2503 at C2 results in a weak reverse transcriptase stop (Fig. 3A). When 23S rRNA extracted from the ΔyfgB strain JW2501 was used as a template, the band corresponding to the reverse transcriptase stop at m2A2503 was not observed, indicating the loss of m2A2503 modification in this strain. When the ΔyfgB strain was transformed with a plasmid overexpressing the YfgB protein (Kitagawa et al. 2005), the reverse transcriptase stop reappeared (Fig. 3B) establishing a causative relationship between the presence of yfgB and post-transcriptional modification of A2503 in E. coli.
Primer extension analysis of 23S rRNA. (A) rRNA from a control wild-type E. coli strain BW25113 (wt) and yfgB (rlmN) knockout mutant strain (ΔyfgB); sequencing lanes (A,G) are indicated. (B) rRNA from the E. coli yfgB knockout strain transformed with the yfgB expression plasmid (ΔyfgB/pyfgB) or with the empty vector (ΔyfgB/pCA24N); sequencing lane (A) is marked. (C) rRNA from S. aureus: “RN6390B,” control laboratory strain; “CM05” clinical isolate CM05 that carries the cfr gene (Toh et al. 2007); “1128-KO,” S. aureus Newman strain with the insertionally inactivated gene NWMN_1128, “control-KO,” S. aureus Newman strain with the insertionally inactivated neutral gene NWMN-1912; “NWMN,” wild-type Newman strain.
We further investigated the presence of m2A2503 modification in the ΔyfgB strain by two-dimensional thin-layer chromatography (2D-TLC). Many modified nucleotides present in rRNA, including m2A, can be resolved by 2D-TLC and are characterized by defined chromatographic mobilities (Bochner and Ames 1982; Keith 1995). The oligonucleotide-protection technique was used to prepare a short segment of 23S rRNA that encompasses position 2503 (Kowalak et al. 1995; Andersen et al. 2004). A 41-nucleotide (nt)-long oligonucleotide (Fig. 1) was hybridized to 23S rRNA isolated from wild-type or ΔyfgB strains; the unhybridized RNA was digested by RNase A and the protected rRNA segment was purified by gel electrophoresis. The RNA fragment was then hydrolyzed to 3′-mononucleotides by RNase T2. The nucleotides were 5′ labeled by incubation with γ-[32P]-ATP and polynucleotide kinase and, after removal of the 3′-phosphate by nuclease P1 hydrolysis, the nucleoside-5′-monophosphates were separated by 2D-TLC (Fig. 4; Bochner and Ames 1982). A spot with the characteristic mobility of m2A was present in the sample derived from wild-type rRNA but was absent in rRNA prepared from the ΔyfgB strain. This result confirmed that A2503 remains unmodified in the absence of YfgB and thus established YfgB as the methyltransferase responsible for post-transcriptional modification of A2503 to m2A. In agreement with the accepted convention (Ofengand and Del Campo 2004; Andersen and Douthwaite 2006), we propose to rename YfgB protein as RlmN (rRNA large subunit methyltransferase gene N).
2D-TLC analysis of nucleotides from the yfgB knockout and wild-type E. coli 23S rRNA fragment. The positions of 5′ monophosphate UV markers are indicated by dashed-line circles. The radioactive spots used for alignment of the PhosphorImager scans with the TLC plates are circled with a solid line.
An unidentified spot, marked X in Figure 4, was observed in both samples. The origin of this spot is unknown but it can correspond to the partially modified C2501. The exact nature of the modification of C2501 has not been determined, but from the results of mass-spectrometric analysis it is compatible with 2-thiocytidine (Andersen et al. 2004).
The RlmN homolog in Staphylococcus aureus
The 23S rRNA of Thermus thermophilus and Bacillus megaterium is methylated at the position equivalent to E. coli m2A2503 (Mengel-Jorgensen et al. 2006). However, the extent of conservation of the A2503 modification within the evolutionary domain of Bacteria is unknown. Given its location in the functionally important site in the ribosome and proximity to the site of action of clinically important antibiotics, it was interesting to investigate whether this modification, and the enzyme corresponding to the E. coli RlmN, is present in Gram-positive bacterial pathogens. A BLAST search against the complete UniProtKB database (http://www.ebi.ac.uk/uniprot/) using the YfgB protein sequence as query and a threshold E value of 0.001 identified >500 bacterial proteins with highly significant similarity (>55%) to YfgB. Among these proteins was the polypeptide encoded by the gene NWMN_1128 of the clinical Staphylococcus aureus strain Newman, which exhibited 36% sequence identity to E. coli protein RlmN. It was a likely candidate for the enzyme responsible for A2503 modification in wild-type S. aureus. Primer extension carried out on 23S rRNA prepared from the S. aureus laboratory strain RN6390B and the clinical strain Newman showed the presence of weak reverse transcriptase stops corresponding to the possible occurrence of post-transcriptional modification at A2503 (Fig. 3C). However, when 23S rRNA prepared from the S. aureus Newman strain in which the NWMN_1128 gene was inactivated by transposon insertion (Bae et al. 2004) was analyzed, the corresponding band was no longer present (Fig. 3C). This result indicated that the position equivalent to E. coli A2503 is post-transcriptionally modified in S. aureus and that the protein encoded by the NWMN_1128 gene is responsible for this modification. By analogy with E. coli, we expect that S. aureus carries m2A modification at position 2503 of 23S rRNA.
The lack of methylation of A2503 in E. coli 23S rRNA reduces cell fitness
Inactivation of rlmN (yfgB) did not notably affect growth of E. coli in LB medium (data not shown). The rlmN − cells grew with a doubling time of 43 min, comparable to that of wild-type BW25113 cells (41 min) or to a control strain where the kanamycin marker replaced the xylA gene, which is nonessential for growth in rich medium (44 min). However, in a co-growth competition experiment, the rlmN knockout mutant showed reduced fitness compared to wild type (Fig. 5). In a mixed culture initially containing equal proportions of wild-type and mutant cells, the representation of the rlmN mutant reduced to 6% after six dilutions (∼50 doublings). Similarly, rlmN knockout cells also lost in co-growth competition with the control xylA knockout strain. Thus, the absence of m2A2503 modification produces a subtle but significant effect on cell fitness apparently through its effect on protein synthesis or ribosome assembly.
Growth of ΔyfgB cells in competition with the initially equal number of wild-type (closed boxes) and ΔxylA mutant cells (open boxes). The percent of ΔyfgB cells in the population was determined at each cycle by plating as described in Materials and Methods.
The lack of m2A2503 modification affects antibiotic sensitivity
Acquired antibiotic resistance enzymes often target rRNA and prevent drug binding by modifying specific rRNA residues, usually via attaching one or several methyl groups (Weisblum 1995; Mann et al. 2001; Treede et al. 2003; Kehrenberg et al. 2005). A2503 is the target of modification by Cfr methyltransferase, which renders cells resistant to phenicols, lincosamides, oxazolidinones, pleuromutilins, and streptogramin A antibiotics (Long et al. 2006). In some cases, the lack of natural modification at specific rRNA positions may influence susceptibility of bacterial cells to antibiotics (Helser et al. 1972; Van Buul et al. 1983; Johansen et al. 2006; Okamoto et al. 2007). Therefore, we tested susceptibility of the rlmN knockout E. coli mutant to an array of peptidyl transferase-targeting antibiotics. Though E. coli is naturally resistant to many antibiotics owing to active efflux, high concentrations of the drugs do inhibit protein synthesis and cell growth (Xiong et al. 2000). The E. coli rlmN knockout strain showed a small but reproducible twofold increased susceptibility to tiamulin, hygromycin A, and sparsomycin compared to the wild-type strain (Table 1). Inactivation of rlmN in S. aureus resulted in twofold increased susceptibility to linezolid.
Antibiotic susceptibility of the RlmN knockout strains in E. coli and S. aureus compared with the control strains
DISCUSSION
We have identified the enzyme responsible for “natural” post-transcriptional modification of A2503 to m2A in E. coli 23S rRNA. Cells lacking the gene yfgB (rlmN) carried unmodified A at position 2503 of 23S rRNA. Reintroduction of rlmN into the knockout strain restored modification. These result unequivocally established RlmN as the methyltransferase that modifies A2503 in 23S rRNA to m2A.
There are 14 post-transcritionally modified purine residues in rRNA of the E. coli ribosome (Andersen and Douthwaite 2006). All the post-transcriptional modifications of purines in rRNA entail transfer of one or several methyl groups to the nitrogen base or to the ribose. In most cases, the methyl-accepting groups (endo- or exocyclic nitrogen atoms of the purine base or 2′oxygen of the ribose sugar) are nucleophilic and the methylation reaction proceeds through a classic alkylation mechanism involving the methyl group of SAM. The only nucleotide in rRNA that is methylated at the carbon atom of the purine base is A2503. Low nucleophilicity of the adenine's C2 makes this reaction much more challenging in chemical terms than the classic methylation reaction and calls for a principally different reaction mechanism (Wang and Frey 2007). It is not surprising, therefore, that the enzyme responsible for this reaction, RlmN, exhibits little similarity to other known methyltransferases that operate on rRNA.
The amino acid sequence of RlmN shows characteristic signatures of a superfamily of proteins known as radical SAM enzymes (marked as “motifs” in Fig. 2) (Sofia et al. 2001; Kozbial and Mushegian 2005). All radical SAM enzymes contain the cysteine-rich motif CxxxCxxC (in RlmN: C124ALECKFC, motif 1 in Fig. 2), which is involved in chelation of the [4Fe–4S]1+ cluster. The cluster initiates a reductive cleavage of SAM, resulting in formation of 5′ deoxyadenosyl radical. This radical then abstracts a hydrogen atom from a chemically unreactive CH group thereby leading to its chemical activation. The general role of SAM in radical SAM enzymes is thus of a substrate for generation of reactive radical. In regards to RlmN, this mechanism will imply that one molecule of SAM will be consumed to generate a 5′deoxyadenosyl radical that will activate the C2 aromatic carbon atom of the adenine base. The source of the methyl group that is then transferred to the activated C2 carbon atom of adenine 2503 is unknown, but by analogy with some other radical SAM methyltransferases, one can expect that a second molecule of SAM may serve as the methyl donor (Pierrel et al. 2004; Hernandez et al. 2007).
We have shown that a protein with the structure, and likely function, similar to that of RlmN of Gram-negative E. coli is encoded in the genome of phylogenetically distant Gram-positive S. aureus. Though we have not explicitly analyzed the phylogenetic distribution of rlmN-like genes among sequenced genomes, BLAST search shows that close RlmN homologs are encoded in chromosomal DNA of many Gram-negative and Gram-positive bacteria (Fig. 2). The presence of methylated A2503 in 23S rRNA was experimentally detected in three bacterial species, E. coli, T. thermophilus, and B. megaterium (Kowalak et al. 1995; Mengel-Jorgensen et al. 2006). Proteins with considerable (30%–50%) similarity to RlmN are also encoded in genomes of several unicellular eukaryotes (Fig. 2) indicating that the adenine residue corresponding to the bacterial A2503 may be post-transcriptionally modified in these species. BLAST search in the archaeal genomes revealed proteins with only limited similarity to RlmN. However, at least one report mentioned the presence of m2A2503 in 23S rRNA of an archaeon Haloarcula marismortui (cited in Mengel-Jorgensen et al. 2006). Thus, it appears that the modification of A2503 to m2A is conserved among evolutionarily distant species.
A rather “difficult” chemistry involved in formation of m2A2503 implies that there must have been a compelling reason for the cells to evolve an enzyme catalyzing this reaction. Furthermore, broad distribution of RlmN homologs among species indicates that there is strong evolutionary pressure to maintain post-transcriptional modification of A2503 in rRNA. What could the functional purpose of having adenosine at position 2503 in 23S rRNA modified be? A2503 is located at the entrance to the nascent peptide exit tunnel and is exposed in the tunnel lumen (Ban et al. 2000). It tops the stack of three adenines (A2058/A2059/A2503) (Fig. 6). These nucleotides, which are located at the constriction of the nascent peptide tunnel, might be a part of the mechanism that monitors the sequence of the nascent peptide (Mankin 2006). Indeed, mutations in A2058 were shown to affect the ribosome stalling during translation of the SecM nascent peptide, which depends on the ribosome-nascent peptide interaction (Nakatogawa and Ito 2002). In the crystallographic structures of the large ribosomal subunits of H. marismortui, T. thermophilus, and E. coli, the base of A2503 is in syn conformation but in the Deinococcus radiodurans 50S subunit, A2503 was modeled in anti conformation (Ban et al. 1998; Harms et al. 2001; Schuwirth et al. 2005; Selmer et al. 2006). Since the modification status of A2503 in D. radiodurans is unknown (even though D. radiodurans genomes encodes a protein homologous to RlmN), it is unclear whether this difference results from the lack of A2503 methylation or is a mere reflection of insufficient resolution. Nevertheless, a possible syn–anti transition of A2503 or, in general, the exact orientation of the base should be affected by the presence of the C2 methyl group (Saenger 1984). Directly, or indirectly (via changing conformation of A2059 and/or A2058), the precise placement of A2503 base may influence the contacts between the tunnel wall and the nascent peptide and could be a part of the ribosome response mechanism to specific nascent peptides in the tunnel.
Position of the A2503 (red) in the E. coli ribosome (Schuwirth et al. 2005) relative to the tRNA substrates docked in the P site (light green) and A site (light blue) (Leach et al. 2007). A2503 is located within 9 Å of peptidyl tRNA and its base stacks on top of A2059 and A2058, located at the constriction of the nascent peptide tunnel. The C2 methyl group added to A2503 by RlmN is indicated by a red ball.
RlmN was initially identified on the basis of its homology with Cfr, an enzyme that hypermethylates A2503 and renders cells resistant to several antibiotics, inhibitors of the peptidyl transferase activity (Schwarz et al. 2000, 2004). In cells that acquire cfr, A2503 has not one extra methyl group, as m2A2503 in wild-type rRNA, but two. However, the exact placement of the second methyl group in the Cfr-modified A2503 is unknown (Kehrenberg et al. 2005). Given that, similar to RlmN, Cfr belongs to the radical SAM enzyme superfamily, one would expect that the Cfr-catalyzed methylation reaction should also involve a CH center. The only aromatic carbon atom available for methylation in m2A is C8. Even though C8-methylated adenine has not yet been found in natural RNAs, it is possible that Cfr utilizes the radical mechanism to methylate this chemically inert center. Another possibility is that Cfr converts m2A to 2-ethyladenosine. Though unusual, such a modification appears to be compatible with the published results of mass spectrometry of Cfr-modified 23S rRNA (Kehrenberg et al. 2005).
Hypermethylation of A2503 by Cfr confers resistance to several drugs that bind in the vicinity of this nucleotide in the peptidyl transferase center (Long et al. 2006). The lack of A2503 natural modification in the E. coli rlmN knockout strain led to a modest increase in susceptibility to tiamulin, hygromycin A, and sparsomycin, confirming that the modification status of A2503 affects antibiotic sensitivity. This result is in line with a growing perception that the loss of natural post-transcriptional modifications in rRNA may affect susceptibility of bacterial cells to antibiotics, a notion that may have clinical implications (Helser et al. 1972; Van Buul et al. 1983; Johansen et al. 2006; Okamoto et al. 2007).
MATERIALS AND METHODS
Strains and plasmids
The collection of gene knockout mutants of the E. coli strain BW25113 (Keio collection) was obtained from Nara Institute of Science and Technology (Baba et al. 2006). The strain JW2501 in the collection, which has the yfgB gene replaced with the kanamycin resistance cassette, was used in the experiments. The gene replacement was verified by PCR analysis. The strain JW3537, in which the kanamycin resistance cassette replaces xylA gene dispensable for growth in rich media, was used as control in some experiments. Plasmid expressing yfgB was from the ASKA library strain JW2501 (Kitagawa et al. 2005).
S. aureus strains used in this work include RN6390B (Novick et al. 1993), Newman (wild type), and the following transposon mutants: NWMN_1128 (the yfgB gene homolog) and NWMN_1912 (a prophage gene), the control mutant. The mutants were generated by transducing the transposon insertions from the ΦNΞ-0032 and ΦNΞ-3200 strains of the Phoenix library of bursa aurealis mutants (Bae et al. 2004) into Newman wild-type strain with the staphylococcal phage Φ85.
Isolation of total cellular RNA and primer extension analysis
For isolation of total RNA, E. coli or S. aureus cells were grown in LB broth or tryptic soy broth, respectively, to an optical density of A550 = 1. E. coli RNA was isolated using the TRIzol kit (Invitrogen) whereas S. aureus RNA was isolated using the UltraClean Microbial RNA Isolation Kit (Mo Bio Laboratories) according to the manufacturer's protocols.
Primer extension analysis was carried out following the published protocol (Merryman and Noller 1998) with some modifications. Ten picomoles of the DNA primer TCGCGTACCACTTTA, complementary to the positions 2563–2577 of 23S rRNA (E. coli numbering), were 32P-5′-terminally labeled by incubation in the final volume of 10 μL with 10 μCi (1.7 pmol) γ-[32P] ATP (6000 Ci/mmol) and 10 units of polynucleotide kinase in a 1× polynucleotide kinase buffer (Fermentas). Reaction was incubated at 37°C for 30 min and then stopped by incubation for 2 min at 90°C.
We combined 0.5 pmol of labeled primer with 2 μg of total cellular RNA in 4.5 μL of hybridization buffer (50 mM HEPES-KOH at pH 7, 100 mM KCl). Reactions were incubated at 90°C for 1 min and then cooled over ∼10 min to 45°C. Annealed reactions were then centrifuged for 15 sec to collect any condensate.
An extension reaction premix contained 0.65 μL of 10× reaction buffer (1.3 M Tris-HCl at pH 8.5, 100 mM MgCl2, 100 mM DTT), 1.5 μL of dNTP mix (1 mM dGTP, 1 mM dATP, 1 mM dTTP, and 1 mM dCTP), 0.75 μL of RNase-free water, and 0.1 μL (3 units) of AMV reverse transcriptase (Seikagaku America) per reaction. The amount of premix was adjusted according to the number of samples to be analyzed. We added 3 μL of the pre-mix to each reaction tube with the annealed primer/RNA complex. Samples were incubated at 42°C for 30 min. Following incubation, 120 μL of stop buffer (84 mM NaOAc at pH 5.5, 70% EtOH, 0.8 mM EDTA) were added to each tube followed by centrifugation at maximum speed for 10 min at room temperature. After complete removal of supernatant and air-drying of the tubes for 2–3 min, the pellets were resuspended in 5 μL of formamide loading dye (Sambrook et al. 1989). We loaded 2 μL onto a 5-mm- wide slot of a 20 cm × 40 cm × 0.25 mM, 6% urea-polyacrylamide gel. The gel was run at 40 W until the bromophenol blue dye reached the bottom of the gel. The gel was transferred to Whatman 3MM paper, dried, and exposed on a phosphorimager screen. The screen was scanned on a Molecular Dynamics PhosphorImager, and the band intensities were quantified using Molecular Dynamics Image Quant software.
Preparation of an rRNA segment encompassing A2503
E. coli cells were grown in liquid LB medium to an optical density of A550 = 0.4 and harvested by centrifugation. Cells were washed and resuspended in Buffer A (20 mM Tris-HCl at pH 7.5, 100 mM NH4Cl, 10 mM MgCl2, 0.5 mM EDTA, 6 mM BME). The cells were lysed by passing them through a French press, and cell debris was removed by centrifugation (15 min at 16,000 rpm, then 10 min at 24,000 rpm in the Beckman JA25 rotor, at 4°C). Ribosomes were collected from the supernatants by centrifugation at 33,000 rpm for 22 h at 4°C in a Beckman Ti70 rotor. The pellet was resuspended in resuspension buffer (50 mM Tris-HCl at pH 7.5, 150 mM NH4Cl, 5 mM MgCl2, 6 mM BME) and stored at −80°C. We diluted 330 A260 of ribosomes in extraction buffer 0.3 M NaOAc (pH 5.5) to the final volume of 1000 μL, and rRNA was isolated by three repeated extractions with equal volumes of phenol/chloroform followed by ethanol precipitation.
To isolate a defined rRNA sequence, 1200 pmol of a 41-nt DNA oligonucleotide, GATGTGATGAGCCGACATCGAGGTGCCAAACACCGCCGTCG, complementary to the 23S rRNA segment 2480–2520 of E. coli 23S rRNA, were combined with 400 pmol of total rRNA and 60 μL hybridization buffer (250 mM HEPES, 500 mM KCl at pH 7) in a total volume of 200 μL. The mixture was incubated for 5 min at 90°C and then allowed to cool to room temperature over 1.5 h. We added 0.00625 μg of RNase A (Sigma-Aldrich)/pmol rRNA, followed by a 50 min incubation at 37°C. The reaction was extracted once with phenol/chloroform. Nucleic acids were ethanol precipitated, dissolved in water, and incubated with RQ1 DNase (Promega) at 37°C for 15 min. Following another phenol/chloroform extraction and ethanol precipitation, the protected rRNA fragment was purified on a 13% polyacrylamide gel containing 7 M urea. Bands were visualized by ethidium bromide staining, and the RNA band was excised and eluted overnight at 24°C in 0.3 M NaOAc (pH 5.5). RNA was extracted with phenol, phenol/chloroform, chloroform and ethanol precipitated.
Analysis of nucleotide composition by 2D-TLC
The isolated rRNA fragment (0.1–0.5 μg) was denatured by incubation at 65°C for 5 min and then placed on ice. The denatured RNA was digested to nucleoside 3′ phosphates with 10 units of RNase T2 (Invitrogen) for 15 min at 37°C. The 3′ mononucleotides were then 5′ 32P phosphorylated by incubation with 10 μCi (1.7 pmol) γ-[32P] ATP (6000 Ci/mmol) and 10 units polynucleotide kinase in a 1× polynucleotide kinase buffer (Fermentas). The reaction was extracted with phenol-chloroform-isoamyl alcohol (25:24:1) and chloroform and then incubated with 2 μg of nuclease P1 (USBiological) for 3 h to overnight at 37°C. Prior to loading on TLC plates, the radiolabeled sample was mixed with 1 μL of the marker comprising 1 A260 of each of 5′ AMP, GMP, CMP, and UMP.
Two-dimensional separation of the 5′-[32P] nucleoside monophosphates was performed on glass-backed polyethyleneimine cellulose F plates (Merck). Plates (20 cm × 10 cm) were developed at room temperature (first dimension: 20 cm, second dimension:10 cm). The solvent systems used were the following: first dimension: isobutyric acid: NH4OH conc: H2O=66:1:33, second dimension: isopropanol: HCl: H2O=70:15:15. Identification of each radiolabeled spot on the plate was performed by comparison with those in published reference maps (Keith 1995).
Cell growth experiments and microbiological testing
The growth rates of wild-type BW25113, YfgB− and XylA− strains were determined during exponential growth phase in triplicate cultures at 37°C in rich LB liquid media. Overnight cultures were diluted to an optical density of A550 = 0.01 and growth was monitored at A550 every 20 min.
A co-growth competition experiment was performed in LB media at 37°C as described (Gutgsell et al. 2000). Initially, 10 μL each from an overnight culture of kanamycin-sensitive BW25113 parental strain and kanamycin-resistant YfgB− cells were mixed in 10 mL of LB media. At each 6-h interval, the culture was diluted 1000-fold. At the same time, serial dilutions of the cultures were plated on LB agar and LB agar supplemented with kanamycin (30 μg/mL). The plates were incubated at 37°C and the colonies were counted.
A co-growth competition assay with XylA knockout strain was performed in a similar way except that cells were plated on MacConkey agar plates supplemented with 1% (w/v) D-xylose. On these plates, XylA− cells formed white colonies whereas YfgB− cells formed red colonies.
Antibiotic sensitivity testing was performed using CLSI-approved protocol (National Committee for Clinical Laboratory Standards 2003).
ACKNOWLEDGMENTS
We wish to thank Stephen Douthwaite and Birte Vester, University of Southern Denmark, for sharing information and advice on experiments. This work was supported by NIH grant RO1 AI072445 to A.S.M.
Footnotes
-
Reprint requests to: Alexander S. Mankin, Center for Pharmaceutical Biotechnology, m/c 870, University of Illinois, 900 S. Ashland Avenue, Chicago, IL 60607, USA; e-mail: shura{at}uic.edu; fax: (312) 413-9303.
-
Article published online ahead of print. Article and publication date are at http://www.rnajournal.org/cgi/doi/10.1261/rna.814408.
-
- Received September 6, 2007.
- Accepted October 9, 2007.
- Copyright © 2008 RNA Society