Rat1p and Rai1p function with the nuclear exosome in the processing and degradation of rRNA precursors
Abstract
Exoribonucleases function in the processing and degradation of a variety of RNAs in all organisms. These enzymes play a particularly important role in the maturation of rRNAs and in a quality-control pathway that degrades rRNA precursors upon inhibition of ribosome biogenesis. Strains with defects in 3′–5′ exoribonucleolytic components of the RNA processing exosome accumulate polyadenylated precursor rRNAs that also arise in strains with ribosome biogenesis defects. These findings suggested that polyadenylation might target pre-rRNAs for degradation by the exosome. Here we report experiments that indicate a role for the 5′–3′ exoribonuclease Rat1p and its associated protein Rai1p in the degradation of poly(A)+ pre-rRNAs. Depletion of Rat1p enhances the amount of poly(A)+ pre-rRNA that accumulates in strains deleted for the exosome subunit Rrp6p and decreases their 5′ heterogeneity. Deletion of RAI1 results in the accumulation of poly(A)+ pre-rRNAs, and inhibits Rat1p-dependent 5′-end processing and Rrp6p-dependent 3′-end processing of 5.8S rRNA. RAT1 and RAI1 mutations cause synergistic growth defects in the presence of rrp6-Δ, consistent with the interdependence of 5′-end and 3′-end processing pathways. These findings suggest that Rai1p may coordinate the 5′-end and 3′-end processing and degradation activities of Rat1p and the nuclear exosome.
Keywords
INTRODUCTION
The biogenesis of ribosomes requires the processing of rRNA precursors (pre-rRNAs) that contain external and internal sequences not found in the mature rRNA molecules (Kressler et al. 1999; Venema and Tollervey 1999). RNA polymerase I synthesizes a pre-rRNA that contains the sequences of three rRNAs, separated by two internal transcribed spacers (ITS1 and ITS2) and flanked by two external transcribed spacers (5′-ETS and 3′-ETS). A series of endonucleolytic and exonucleolytic cleavages must occur to produce the mature 18S, 5.8S, and 25S rRNAs contained within this primary pre-rRNA (Fig. 1). Early cleavage at site A2 or A3 results in the separation of the 20S and 27SA2 pre-rRNAs or 27SA3 pre-rRNAs. The cleavage at A3 by RNase MRP and processing at B1L provide alternative pathways for the formation of the 5′-end of 5.8S rRNA. In both of these pathways, cleavage at C2 within ITS2 separates the 5.8S precursors, 7S pre-rRNA, from a 5′-extended form of 25S rRNA. Trimming by the 5′–3′ exoribonuclease Rat1p forms the mature 5′-ends of 25S and 5.8SS rRNAs (Amberg et al. 1992; Henry et al. 1994; Geerlings et al. 2000). In the case of 5.8SS, efficient 5′-end processing by Rat1p from the RNase MRP cleavage site A3 to B1S requires the Rat1p-associated protein Rai1p, and some of the trimming may result from the action of the cytoplasmic, 5′–3′ exoribonuclease Xrn1p (Henry et al. 1994; Xue et al. 2000). The combined actions of the nuclear exosome, Rex1p, Rex2p, and Ngl1p trim the 3′-end of 7S pre-rRNA to produce the same 3′-end in the mature forms of 5.8SS and 5.8SL (Briggs etal. 1998; Allmang et al. 1999a; van Hoof et al. 2000a; Faber et al. 2002). In Saccharomyces cerevisiae, the actions of the alternative 5′-end processing pathways result in ~ 20% of mature ribosomes carrying 5.8SL, while 80% carry 5.8SS.
A nuclear RNA quality control appears to play a role in degrading improperly processed, or excess rRNA precursors. Defects in components of the exosome, including the nuclear 3′–5′ exoribonuclease Rrp6p, cause the accumulation of rRNA processing intermediates generated by steps that do not require the nuclear exosome (Allmang et al. 2000). Depletion of proteins required for early steps in rRNA processing resulted in the accumulation of polyadenylated forms of 27S pre-rRNA (Fang et al. 2004). Since mutation or depletion of exosome components also caused the accumulation of poly(A)+ pre-rRNAs, Fang and Kuai proposed that polyadenylation might target pre-rRNAs for degradation by the nuclear exosome (Fang et al. 2004; Kuai et al. 2004). Analysis of the size of the accumulated poly(A)+ 27S pre-rRNAs in rrp6-Δ strains revealed a 5′ heterogeneity consistent with the involvement of 5′–3′ exoribonuclease in their degradation. However, the identity of this activity remained unclear. In this report, we present evidence that Rat1p plays a role in the degradation of these RNAs. Analysis of the role of the Rat1p-associated protein Rai1p indicates that it also plays a role in the degradation of poly(A)+ pre-rRNAs. Interestingly, Rai1p appears to function in the 5′-end and 3′-end processing of 5.8S rRNA, suggesting that it may link the processing activities of Rat1p and the nuclear exosome.
RESULTS
Depletion of Rat1p causes growth and rRNA-processing defects
We replaced the chromosomal RAT1 promoter with the repressible tetO7 promoter to permit doxycycline-dependent inactivation of Rat1p expression, thus allowing studies of the effects of the loss of Rat1p activity on rRNA processing in RRP6 and rrp6-Δ cells. The addition of 2 μg/mL doxycycline inhibits the growth of the RRP6, tetO7–RAT1 strain, and increasing the level of doxycycline to 5 μg/mL resulted in complete inhibition of growth, consistent with the essential function of Rat1p in yeast (Fig. 2). At 2 μg/mL, the level of doxycycline-dependent growth inhibition of an rrp6-Δ, tetO7–RAT1 strain was similar to that observed for the RRP6, tetO7–RAT1 strain, suggesting that no synergistic defects result from this degree of Rat1p depletion in the absence of Rrp6p (Fig. 2). Moreover, the rrp6-Δ, tetO7–RAT1 strain could not grow in the presence of 5 μg/mL doxycycline, indicating that deletion of RRP6 does not bypass the growth requirement for RAT1 (Fig. 2).
Mutations in RRP6 and other nuclear exosome components render yeast cells hypersensitive to the antimetabolite 5-fluorouracil (5FU) (Fig. 2; Fang et al. 2004; Lum et al. 2004). The presence of 20 μM 5FU inhibits the growth of the RRP6, tetO7–RAT1 strain in the absence of doxycycline-induced inactivation of Rat1p expression, but has no effect on the growth of the normal RRP6, RAT1 strain (Fig. 2). This 5FU hypersensitivity suggests that the tetO7 promoter supplies a subnormal level of Rat1p to the cell under these conditions. Consistent with this conclusion, depletion of Rat1p by the addition of 2 μg/mL doxycycline enhances the effect of 5FU on the growth of the RRP6, tetO7–RAT1 strain (Fig. 2). Combination of the tetO7–RAT1 and rrp6-Δ mutations results in a synergistic growth defect in the absence of doxycycline.
Next, we analyzed the effect of doxycycline-induced depletion of Rat1p on the processing of 5.8S rRNA by comparing its levels and that of its precursors with the level of the stable SCR1 RNA. The efficient conversion of the 27S-A3 pre-rRNA to 27S-B1S requires the combined activities of Rat1p, Rai1p, and Xrn1p (Fig. 1; Amberg et al. 1992; Henry et al. 1994; Xue et al. 2000). Cleavage at C2 within ITS2, followed by 3′-end trimming by the nuclear exosome, Rex1p, Rex2p, and Ngl2p, produces mature 5.8SS rRNA, which comprises 75%–80% of the mature 5.8S rRNA in yeast cells (Fig. 3, lane 1). 5.8SL, produced by 5′-end formation at B1L and the same 3′-end-trimming pathway required for 5.8SS, makes up the remaining 20%–25% of mature 5.8S rRNA (Briggs et al. 1998; van Hoof et al. 2000a; Faber et al. 2002). Analysis of the combined deletion of RRP6 and depletion of Rat1p reveals four significant observations. First, depletion of Rat1p results in the expected decrease in the amount of 5.8SS rRNA, without changing the level of 5.8SL rRNA (Fig. 3, lanes 3,4). Depletion of Rat1p also causes a twofold increase in the level of 7S pre-rRNA, the immediate 3′-end extended precursor to 5.8S+27 pre-rRNA and 5.8S rRNA, as well as an increase in the ratio of long and short forms of 7S pre-rRNA (Fig. 3, lane 4). These findings are consistent with a block in the conversion of 7S pre-rRNA to 5.8SS. Second, deletion of RRP6 causes the accumulation of 3′-extended forms of 5.8S rRNA (5.8S+27) (Fig. 3, lanes 5,6), a decrease in the levels of the mature long and short forms of 5.8S rRNA, and an increase in the amount of the 7S precursor (Fig. 3, cf. lanes 1 and 5). Third, the deletion of RRP6 does not significantly alter the ratio of 5.8SS and 5.8SL, in agreement with previous results indicating that defects in 3′-end trimming of 5.8S pre-rRNAs do not affect formation of the 5′-ends (Briggs et al. 1998; Allmang et al. 1999a). Fourth, this analysis reveals that depletion of Rat1p inhibits the accumulation of 7S and 5.8S precursors caused by deletion of RRP6 (Fig. 3, lane 8). In this case, the most significant effect of Rat1p depletion is a decrease in the normal and 3′-extended forms of 5.8SS. These findings reveal the effectiveness of the Rat1p depletion and suggest that Rat1p may act at a step in the rRNA processing pathway prior to the action of Rrp6p.
Genetic and functional interactions between RAI1 and RRP6
RAI1 encodes a nonessential, 44.5-kD protein that interacts with and modulates the activity of Rat1p (Stevens and Poole 1995; Xue et al. 2000). Previous results indicated that deletion of RAI1 results in a change in the ratio of 5.8SL to 5.8SS similar to that seen in rat1− mutants (Xue et al. 2000). The RAI1 deletion also caused the accumulation of longer forms of 5.8S rRNA, suggestive of a defect in 3′-end formation. We compared the effect of an RAI1 deletion with that of an RRP6 deletion. Northern blot analysis of 5.8S pre-rRNAs using an oligonucleotide that hybridizes to 5.8S rRNA shows the expected decrease in the ratio of 5.8SS to 5.8SL in the rai1-Δ strain (Fig. 4A, lane 3). This analysis also reveals that the rai1-Δ strain accumulates products of the same size as the two forms of 5.8S+27 pre-rRNA found in the rrp6-Δ strain (Fig. 4A, lanes 1,3). The ratio of 5.8SS to 5.8SL in these longer forms is that expected for a defect in 5′-end processing by Rat1p and Rai1p, suggesting that loss of Rai1p causes defects in both the 5′-end and the 3′-end formation of 5.8S rRNA. The effect of the rai1-Δ mutation on 3′-end formation of 5.8S rRNA appears specific since it does not cause a defect in the formation of U24 snoRNA, while the rrp6-Δ mutation clearly shows the previously established 3′ extension of U24 (Fig. 4A, lanes 1,3; Phillips and Butler 2003).
The similar rRNA processing phenotypes of the rai1-Δ and rrp6-Δ strains suggested that Rai1p may play a role in coordinating the 5′ and 3′ processing of 5.8S rRNA. We asked what effect the deletion of these two genes would have on the viability of yeast. First, we created a diploid strain with the genotype: rrp6:KAN/rrp6:KAN, RAI1/rai1:LEU2, containing RRP6 on a single-copy URA3 plasmid (YCpRRP6) (Briggs et al. 1998). Sporulation of this strain allowed us to isolate haploids with the genotypes (1) rrp6:KAN, rai1:LEU2, YCpRRP6 and (2) rrp6:KAN, RAI1, YCpRRP6. Selection for cells that have lost the URA3, YCpRRP6 plasmid yielded viable cells from the second haploid, but not the first (Fig. 4B). The dependence of the first haploid on the presence of YCpRRP6 for viability indicates synthetic lethality of the combined rrp6:KAN and rai1:LEU2 mutations.
Previous studies showed that an RAI1/ rai1-Δ heterozygote did not display sensitivity to 5FU (Fang et al. 2004). Here we compared the sensitivity of an rai1-Δ homozygote with an isogenic rrp6-Δ heterozygote previously shown to display hypersensitivity to 5FU (Fang et al. 2004). The results of this test indicate 5FU sensitivity of the rai1-Δ strain comparable with that of the rrp6-Δ mutant (Fig. 4B, lower panel). This finding suggests that the level of Rai1p in the RAI1/rai1-Δ heterozygote studied by Fang et al. (2004) does not fall below the amount needed to cause 5FU-induced haploinsufficiency, but that the absence of Rai1p does sensitize the cells to the drug.
Rat1p is required for the degradation of poly(A)+ pre-rRNAs
Previous experiments identified poly(A)+ pre-rRNAs in rrp6-Δ and rai1-Δ strains, as well as the enhancement of their accumulation after treatment with 5FU (Fang et al. 2004; Kuai et al. 2004). These experiments also identified 5′-truncated poly(A)+ 27S rRNAs in rrp6-Δ strains, leading to the suggestion that the exosome works in concert with a 5′–3′ exoribonuclease to degrade polyadenylated pre-rRNAs. To test this, we isolated total RNA from normal, rrp6-Δ, and tetO7–RAT1 strains before and after treatment with doxycycline, and we used an oligo(dT)-primed RT-PCR assay that compares the level of poly(A)+ 27S pre-rRNA with that of ACT1 mRNA (Fang et al. 2004). The result shows the expected appearance of poly(A)+ 27S pre-rRNA in the rrp6-Δ, RAT1 and rrp6-Δ, tetO7–RAT1 strains (Fig. 5A, lanes 6–9), but not in the RRP6, RAT1, or RRP6, tetO7–RAT1 strains, irrespective of whether the strains were treated with doxycycline (Fig. 5A, lanes 2–5). We conclude that depletion of Rat1p under these conditions does not cause significant accumulation of poly(A)+ 27S pre-rRNA. Consistent with previous results, this assay detects small amounts of poly(A)+ 27S pre-rRNA that accumulate in an rai1-Δ strain (Fig. 5A, lane 10; Fang et al. 2004).
Next, we isolated poly(A)+ RNA for Northern blot analysis of the size distribution of poly(A)+ 27S pre-rRNAs. Precursor rRNAs were detected with radiolabeled oligonucleotide probes to different regions of the rRNA transcript (Fig. 1) and compared to the levels of ACT1 mRNA (Fig. 5B). Detection of 27S pre-rRNA with a probe (OSB157) hybridizing 3′ of 5.8S rRNA in ITS2 reveals substantial amounts of poly(A)+ 27S pre-rRNA in the rrp6-Δ and rrp6-Δ, tetO7–RAT1 strains in the absence of doxycycline (Fig. 5B, lanes 3–6). Depletion of Rat1p by the addition of doxycycline caused a twofold increase in the level of poly(A)+ 27S pre-rRNA in the rrp6-Δ, tetO7–RAT1 strain (Fig. 5B, lanes 5,6). Poly(A)+ 7S pre-rRNA also accumulates in the rrp6-Δ strain, and the levels are enhanced threefold by introducing the tetO7–RAT1 fusion, but the addition of doxycycline causes no further increase. The accumulation of poly(A)+ 7S pre-rRNA and 5FU sensitivity both occur in rrp6-Δ, tetO7–RAT1 cells in the absence of doxycycline, indicating suboptimal expression of Rat1p from the tetO7 promoter. The fact that the addition of doxycycline enhances poly(A)+ 27S pre-mRNA levels, but not poly(A)+ 7S, indicates that these pre-rRNAs have different sensitivities to the level of Rat1p activity.
Detection of the 5′-truncated forms of poly(A)+ 27S pre-rRNAs requires the use of radiolabeled probes that also hybridize to mature 25S rRNA. Because of the relatively large amount of 25S compared to poly(A)+ 27S rRNA in the cell and the inefficient separation of poly(A)+ and poly(A) − RNAs by oligo(dT)-cellulose, significant amounts of 25S rRNA appear in poly(A)-selected preparations of total RNA (Fang et al. 2004). Nevertheless, Northern blot analysis reveals that deletion of RRP6 results in the accumulation of poly(A)+ 27S rRNAs significantly longer and shorter than the contaminating 25S rRNAs (Fig. 5B, lanes 1–4). Introduction of the tetO7–RAT1 fusion into the rrp6-Δ strain enhances the accumulation of these pre-rRNAs (Fig. 5B, lane 5). Depletion of Rat1p by the addition of doxycycline causes the complete loss of the shortest of these truncated poly(A)+ pre-rRNAs and the enhanced accumulation of full-length poly(A)+ 27S pre-rRNA, indicating a precursor–product relationship between these RNAs (Fig. 5B, lane 6). These results suggest that suboptimal expression of Rat1p from the tetO7–RAT1 fusion, as well as further depletion of Rat1p, inhibits the degradation of poly(A)+ forms of 27S and 7S pre-rRNAs.
DISCUSSION
The observations reported here indicate that Rat1p degrades polyadenylated pre-rRNAs and that Rai1p plays a role in the functional cooperation between Rrp6p and Rat1p during the 3′-end processing of 5.8S rRNA and the degradation of poly(A)+ pre-rRNAs. Rai1p has no similarity to known exoribonucleases and has no nuclease activity in vitro, yet it copurifies with, and enhances the activity of, Rat1p/Xrn2p (Stevens and Poole 1995; Xue et al. 2000). Our findings indicate that deletion of RAI1 results in defects in 5′-end and 3′-end processing of 5.8S pre-rRNAs, suggesting that Rai1p may coordinate these two events. As previously demonstrated, rai1-Δ strains produce abnormally low levels of the short form of 5.8S rRNA and higher levels of the long form, apparently because of the inability of Rai1p to enhance the 5′-end trimming of the precursor by Rat1p (Fig. 4A; Xue et al. 2000). Additionally, rai1-Δ strains fail to efficiently process the 3′-end of 5.8S pre-rRNAs, resulting in 3′-extended 5.8S rRNAs that migrate identically to those that accumulate in rrp6 mutants. We conclude that Rai1p is required for efficient 3′-end processing of 5.8S rRNA by Rrp6p, as well as for 5′-end processing by Rat1p.
Previous experiments showed that poly(A)+ 27S pre-rRNAs with heterogeneous 5′-ends accumulate in rrp6-Δ mutants, an effect enhanced by treatment of the cells with 5FU (Fang et al. 2004). The results shown here implicate Rat1p in the 5′–3′ degradation of these RNAs since their levels increase significantly upon replacement of the RAT1 promoter with tetO7 (Fig. 5B). Depletion of Rat1p caused a shift in the abundance of the truncated forms of poly(A)+ 27S pre-rRNAs from shorter to longer forms, indicating a defect in 5′–3′ degradation. Rai1p also appears to play a role in the degradation of poly(A)+ 27S pre-rRNAs since we detected them by RT-PCR in an rai1-Δ strain (Fig. 5A; Fang et al. 2004). We suggest that these RNAs accumulate in the rai1-Δ strain because of a defect in 3′-end processing since they do not arise upon inactivation of the 5′–3′ processing pathway by depletion of Rat1p and because their detection by RT-PCR dictates that they carry poly(A) tails (Fig. 5A). Presumably, deletion of RRP6 would substantially enhance this effect, but the synthetic lethality of the rai1-Δ, rrp6-Δ mutations complicates such a test. These findings implicate Rrp6p and Rat1p in the exoribonucleolytic degradation of polyadenylated rRNA precursors, and they suggest that Rai1p may coordinate the action of the pathways.
Combination of rai1-Δ and rrp6-Δ mutations results in synthetic lethality (Fig. 4B), while depletion of Rat1p in the presence of rrp6-Δ causes no more of a growth defect than that seen in an rrp6-Δ strain (Fig. 2). The epistatic growth effect in the rrp6-Δ, tetO7–RAT1 mutant may reflect the participation of Rrp6p and Rat1p in the pathway leading to the formation of mature 5.8S rRNA. Consistent with this idea, depletion of Rat1p inhibits the accumulation of 3′-extended forms of 5.8S pre-rRNA in an rrp6-Δ strain (Fig. 3). In contrast to the effects of depletion of Rat1p on cell growth, the addition of 5FU, which inhibits Rrp6p and Rat1p, causes a synthetic growth defect in the in an rrp6-Δ, tetO7–RAT1 strain in the absence of Rat1p depletion (Fig. 2). This finding, along with the fact that the tetO7–RAT1 promoter replacement enhances the accumulation of 5′-truncated poly(A)+ 27S pre-rRNAs in the absence of doxycycline, suggests that this strain produces a suboptimal level of Rat1p, which sensitizes the double mutant to 5FU. In contrast, the tetO7–RAT1 promoter replacement does not cause a defect in the 5′-end processing of 5.8S pre-rRNA in the absence of doxycycline (Fig. 3), consistent with the idea that the 5FU sensitivity of yeast strains reflects a defect in the degradation of abnormal rRNA precursors rather than an inhibition of steps leading to formation of mature rRNAs (Fang et al. 2004).
The nuclear exosome and Rat1p function in RNA processing and degradation pathways that form the 3′-ends and 5′-ends of noncoding RNAs and destroy aberrant or slowly processed RNAs. The 5′-end formation of many snoRNAs requires the activity of Rat1p, as does the maturation of the 5′-end of 25S rRNA (Petfalski et al. 1998; Qu et al. 1999; Geerlings et al. 2000; Lee et al. 2003). Likewise, Rat1p, in conjunction with Rai1p, catalyzes the 5′-end trimming of 5.8S pre-rRNA to give rise to one of the two forms of mature 5.8S rRNA found in ribosomes (Amberg et al. 1992; Henry et al. 1994; Xue et al. 2000). Production of the mature 3′-ends of sno- and snRNAs requires the activity of Rrp6p and the core exosome, in many cases following cleavage of a precursor by the RNase III-type enzyme Rnt1p (Allmang et al. 1999b; van Hoof et al. 2000b).
Rat1p and the nuclear exosome function in pathways that destroy mRNAs in the nucleus under conditions of suboptimal splicing or export to the cytoplasm (Bousquet-Antonelli et al. 2000; Das et al. 2003). Rat1p and Rai1p also catalyze the degradation of the 3′ product of the pre-mRNA cleavage and polyadenylation reaction, and their activities play a role in the subsequent termination of transcription (Kim et al. 2004; West et al. 2004). The nuclear exosome also appears to destroy certain rRNA precursors in normal cells since depletion or mutation of exosome components causes the accumulation of pre-rRNAs that do not require the exosome for their formation (Allmang et al. 2000). The accumulation of polyadenylated pre-rRNAs in rrp6 mutants and the enhancement of this effect by 5FU lead to the suggestion that some defects in rRNA processing result in polyadenylation of aberrant, or unused pre-rRNAs that are targeted for degradation by virtue of acquiring a poly(A) tail (Fang et al. 2004; Kuai et al. 2004). Consistent with this model, depletion of several components required for pre-rRNA processing lead to the accumulation of poly(A)+ 27S pre-rRNA (Fang et al. 2004). The findings reported here indicate that Rat1p participates in the degradation of poly(A)+ 7S and 27S pre-rRNAs. Thus, the nuclear surveillance pathway for rRNA precursors shares with the mRNA surveillance pathway the property that transcripts are degraded in the 5′–3′ as well as the 3′–5′ direction.
In summary, this report provides evidence for the participation of Rat1p in the degradation of polyadenylated pre-rRNAs. Moreover, Rai1p, a protein associated with Rat1p, appears to play a critical role in enhancing the efficiency of pre-rRNA processing and degradation carried out by Rat1p and the nuclear exosome component Rrp6p. The physical and functional details of the apparent coordination of the these activities by Rai1p remain unclear.
MATERIAL AND METHODS
Yeast strains, oligonucleotides, and reagents
Yeast strains are described in Table 1. Yeast strains were grown in yeast extract peptone dextrose (YPD) or synthetic complete dextrose (SCD) media (Sherman 2002). Oligonucleotides used for RT-PCR and Northern blot analysis are listed in Fang et al. (2004). Enzymes were purchased from Invitrogen or Promega. Radioisotopes for oligonucleotide labeling (5′-[γ-32P]dATP; 3000 Ci/mmol) were purchased from NEN Life Science Products. Yeast strain YSB3012 was constructed by introducing the tetO7 promoter immediately upstream of the RAT1 gene in strain R1158 using a previously described strategy (Peng et al. 2003). A PCR product containing the tetO7 promoter and the KANMX cassette flanked by sequences homologous to RAT1 was synthesized in two steps: (1) PCR was performed on genomic DNA from strain RP190 (Peng et al. 2003) using primers OSB416 (5′-CTCATCGAT GAACCTATTACAACATAAAGACATCCCGTAATAATAGCGGA TAACAATTTCACACAGGA-3′) and OSB417 (5′-TGGATAT TTTCGAGATAGCCATCTGAAAAATGACGGAACACCCATGGA TCCCCCGAATTGATC-3′); and (2) the homology to RAT1 extended by PCR of the product with primers OSB418 (5′-TGGATATTTTCG AGATAGCCATCTGAAAAATGACGGAACACCCATGGATCC-3′) (CCCGAATTGATC-3′) and OSB419 (5′-CTATCTGAGGTTGC TCTTCCAATACTGGGGATATGATCTTTGGATATTTTCGAGA TAG-3′). This PCR product was transformed into R1158, and the recombinant was selected for on G418 plates.
Northern blot analysis
Total RNA or poly(A)+ RNA was isolated from yeast strains grown to an A600 of 0.6–0.9 (in SCD media) or 1.0–1.2 (in YPD media) as described (Patel and Butler 1992), and Northern blot analysis was carried out as described in Briggs et al. (1998).
RT-PCR
For cDNA synthesis, 1 μg of DNase-treated total RNA and 1 μL of oligo(dT) (OSB403, 50 pmol/μL) was used in a 20 μL reaction using M-MLV reverse transcriptase (200 units/μL) according to the manufacturer’s instructions (Invitrogen). The 50 μL PCR reactions contained 0.25 μL of cDNA product, 12.5 pmol of oligonucleotide primer, 0.025 mM dNTPs, 2.5 mM MgCl2, and 0.25 μL of GoTaq DNA polymerase (Promega; 5 units/μL). PCR was performed with the following conditions: 94°C for 3 min followed by 20 cycles (94°C for 30 sec, 55°C for 30 sec, and 72°C for 30 sec), followed by 72°C for 7 min and kept at 4°C. Products were separated by electrophoresis in a 2% agarose gel and visualized after staining with ethidium bromide.
Yeast strains used in this study
Diagram of pre-rRNA processing in Saccharomyces cerevisiae. Processing begins with cleavage of the 35S precursor rRNA (35S pre-rRNA) at sites A0 and A1 in the 5′-external transcribed spacer (5′-ETS) and at B2 to yield the 32S pre-rRNA. The exosome and Rrp6p degrade the released 5′-A0 ETS fragment. Cleavage of 32S pre-rRNA at site A2 releases 27SA2 pre-rRNA and 20S pre-rRNA. The latter is converted to mature 18S rRNA by cleavage at site D. The 27SA2 pre-rRNA follows two distinct pathways that produce mature 5.8S and 25S rRNA. These differ in the mechanism that generates the mature 5′-end of 5.8S rRNA. In one pathway, cleavage at A3 by RNase MRP is followed by 5′–3′ trimming of the precursor to produce the 5′-end of 5.8SS rRNA. In the other pathway, cleavage at B1L produces the 5′-end of 5.8SL rRNA. The 3′-end of 5.8S rRNA is formed in each pathway by exonucleolytic removal of the 3′-end of 7S pre-rRNA by the exosome and Rrp6p.
Analysis of the effects of Rat1p-depletion and 5FU treatment on the growth of rrp6-Δ strains. Serial 10-fold dilutions of yeast strains R1158 (RRP6, RAT1), YSB3012 (RRP6, tetO7–RAT1), YSB3014 (rrp6-Δ, RAI1) and YSB3013 (rrp6-Δ, tetO7–RAT1) were spotted on SCD plates with or without the addition of doxycycline and 5FU at the indicated concentrations, and the plates were incubated at 30°C.
Northern blot analysis of the effects of depletion of Rat1p on the 5.8S and 7S pre-rRNAs. Total RNA samples from yeast strains R1158 (RRP6, RAT1), YSB3012 (RRP6, tetO7–RAT1), YSB3014 (rrp6-Δ, RAT1), and YSB3013 (rrp6-Δ, tetO7–RAT1) were analyzed by Northern blotting with OSB157 for 7S pre-rRNA, OSB156 for 5.8S rRNA, or OSB151 for SCR1 (Fang et al. 2004). The table (below) lists the RNA levels that were quantified by storage PhosphorImager analysis and normalized to SCR1 RNA levels. For comparison, the 7S pre-RNA normalized values were each divided by the level in 7S pre-RNA level lane 1. For comparison, each of the 5.8S rRNAs and 5.8S +27 pre-rRNAs, the normalized values were each divided by the amount of 5.8SL in lane 1.
(A) Northern blot analysis of the effects of RAI1-deletion on the levels of 5.8S rRNA and U24 snoRNA. Total RNA samples from yeast strains YSB228 (rrp6-Δ, RAI1), YSB227 (RRP6, RAI1), and YSB229 (RRP6, rai1-Δ) were analyzed by Northern blotting with OSB156 for 5.8S rRNA or OSB138 for U24 (Phillips and Butler 2003). The panel on the right represents a longer exposure of the panel on the left. (B) Effect of rai1-deletions on the growth of RRP6 and rrp6-Δ strains. In the top panel, yeast strains YSB230 (rrp6:KAN, rai1:LEU2, YCpRRP6) and YSB231 (rrp6:KAN, RAI1, YCpRRP6) were streaked for growth at 30°C on SCD −URA plates, or plates containing 5FOA, which selects for cells that have lost the URA3-containing YCpRRP6 plasmid. In the bottom panel, serial 10-fold dilutions of yeast strains YSB227 (RRP6, RAI1), YSB229 (RRP6, rai1-Δ), and YSB228 (rrp6-Δ, RAI1) were grown at 30°C on SCD with or without the indicated levels of 5FU.
(A) RT-PCR analysis of the levels of ACT1 mRNA and poly(A)+ 27S pre-rRNA in yeast strains R1158 (RRP6, RAT1), YSB3012 (RRP6, tetO7–RAT1), YSB3013 (rrp6-Δ, RAT1), YSB3014 (rrp6-Δ, tetO7–RAT1), and YSB229 (RRP6, rai1-Δ). PCR was carried out under conditions in which the level of products is proportional to the amount of RNA added to the RT reactions (Fang et al. 2004). The products were analyzed by electrophoresis on a 2% agarose gel. (B) Northern blot analysis of oligo(dT)-selected RNAs. Total RNA from the yeast strains YSB3013 (rrp6-Δ, RAT1) and YSB3014 (rrp6-Δ, tetO7–RAT1) untreated or treated with 10 μg/mL doxycycline for 24 h was fractionated by binding to oligo(dT)-cellulose, and the poly(A)+ fractions were analyzed by Northern blotting with the indicated radiolabeled oligonucleotide probes.
Acknowledgments
We thank Arlen Johnson (University of Texas, Austin) and Tim Hughes (University of Toronto) for providing plasmids and yeast strains, and we are grateful to the members of our laboratory for helpful discussions and comments on the manuscript. These studies were supported by grants (CA095913 and GM59898) from the NIH.
Footnotes
-
↵1 Present address: Department of Biochemistry and Biophysics, University of Rochester Medical Center, Rochester, NY 14642, USA.
-
Article published online ahead of print. Article and publication date are at http://www.rnajournal.org/cgi/doi/10.1261/rna.2900205.
-
- Accepted June 20, 2005.
- Received April 22, 2005.
- Copyright 2005 by RNA Society
















